ID: 1004557402

View in Genome Browser
Species Human (GRCh38)
Location 6:16712770-16712792
Sequence TAGGGCTAACGTCCTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004557394_1004557402 12 Left 1004557394 6:16712735-16712757 CCCCTTAATCAGCCACCTTCAAA 0: 1
1: 0
2: 1
3: 8
4: 161
Right 1004557402 6:16712770-16712792 TAGGGCTAACGTCCTGCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1004557398_1004557402 -3 Left 1004557398 6:16712750-16712772 CCTTCAAAACAGTGCCTTTCTAG 0: 1
1: 0
2: 1
3: 10
4: 158
Right 1004557402 6:16712770-16712792 TAGGGCTAACGTCCTGCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1004557396_1004557402 10 Left 1004557396 6:16712737-16712759 CCTTAATCAGCCACCTTCAAAAC 0: 1
1: 0
2: 2
3: 19
4: 153
Right 1004557402 6:16712770-16712792 TAGGGCTAACGTCCTGCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1004557397_1004557402 0 Left 1004557397 6:16712747-16712769 CCACCTTCAAAACAGTGCCTTTC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 1004557402 6:16712770-16712792 TAGGGCTAACGTCCTGCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1004557395_1004557402 11 Left 1004557395 6:16712736-16712758 CCCTTAATCAGCCACCTTCAAAA 0: 1
1: 0
2: 0
3: 21
4: 221
Right 1004557402 6:16712770-16712792 TAGGGCTAACGTCCTGCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004557402 Original CRISPR TAGGGCTAACGTCCTGCCTG TGG Intronic
907365889 1:53959440-53959462 TAGGTCTAACCTACTACCTGAGG + Intronic
907905391 1:58780094-58780116 GAGTGCTAATATCCTGCCTGTGG - Intergenic
909018995 1:70410949-70410971 TCGGGCGAACCTCCGGCCTGAGG + Intergenic
912173840 1:107134235-107134257 TGGGGCTAACCTGCTCCCTGTGG + Intergenic
913118482 1:115718151-115718173 TAGTGCTAATGTCTTGCGTGTGG - Intronic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
918354301 1:183692276-183692298 TAGGGCCAACCTCCAGCCTTCGG - Intronic
919732276 1:200920913-200920935 TAGGTCTCAGGTGCTGCCTGTGG + Intergenic
920706973 1:208258627-208258649 TGGCTCTAAAGTCCTGCCTGTGG + Intergenic
920989720 1:210925467-210925489 CAGGGCTAAGAACCTGCCTGAGG - Intronic
1063145295 10:3290458-3290480 CAGGACTCAGGTCCTGCCTGGGG - Intergenic
1074399568 10:113130563-113130585 TAGGGCTATGGTCTTGCTTGTGG + Intronic
1076361411 10:129892034-129892056 TCTGGCCAACGGCCTGCCTGAGG + Intronic
1078346003 11:10549129-10549151 TAGGGCGCAAGTCCTGCCAGAGG + Intergenic
1088587126 11:111369104-111369126 TAGGGGTATCTTGCTGCCTGGGG - Intronic
1093245265 12:16728796-16728818 TAGAGTTAACGTTGTGCCTGAGG - Intergenic
1094739361 12:33270972-33270994 TAGGTCTAACGTACTGCCCAAGG + Intergenic
1096512938 12:52141816-52141838 TAGGGCTTACCTCCTGGGTGAGG - Intergenic
1104561941 12:129853662-129853684 TAGGGCCAACGTGCTCTCTGAGG + Intronic
1112195503 13:97222244-97222266 TAGGGCTGACGAGCTGGCTGGGG + Intronic
1119091791 14:71789650-71789672 CATGGCTTACATCCTGCCTGAGG - Intergenic
1121405944 14:93719525-93719547 TAGGGCTAGGGTCCTGCCCAGGG + Exonic
1122548392 14:102537471-102537493 TAGGTCTGAGGACCTGCCTGGGG - Intergenic
1122898908 14:104774011-104774033 CGGGGCTGCCGTCCTGCCTGTGG - Intronic
1125388581 15:39166545-39166567 TATGTCTAACTTCCTGCTTGGGG - Intergenic
1126087303 15:45022514-45022536 TAGGTCTGAGGTGCTGCCTGAGG - Intergenic
1128550965 15:68597747-68597769 TCGGGCAAAAGTCCAGCCTGCGG + Intronic
1128804660 15:70521839-70521861 CAGGGATCACATCCTGCCTGGGG - Intergenic
1131110389 15:89761139-89761161 GAGGGCAAACGGCCTGCCTGGGG - Intronic
1138679469 16:58674696-58674718 TGGGGCTCATGTCCTGGCTGGGG - Intronic
1139675597 16:68520943-68520965 CTGGGCTCACGGCCTGCCTGGGG - Intergenic
1141935617 16:87236140-87236162 AAGGGCTAACTTCCTTCCCGTGG - Intronic
1143109057 17:4543414-4543436 AAGGGCCAACTGCCTGCCTGGGG + Intronic
1144164899 17:12601144-12601166 AAGGGCTACTGTCCTGTCTGTGG + Intergenic
1148238197 17:45983266-45983288 TGGGGCTCCCCTCCTGCCTGAGG + Exonic
1155032988 18:22000743-22000765 TAGAGCTAAAGTTCTGCTTGGGG + Intergenic
1157586192 18:48802798-48802820 TGGTACTAACGTCCTCCCTGAGG + Intronic
1163237828 19:16039604-16039626 TAGGACAAACCCCCTGCCTGAGG + Intergenic
1163644349 19:18479963-18479985 CAGGGAGAACGTGCTGCCTGGGG - Intronic
926107706 2:10162743-10162765 GAGGGCAAACGCCCTGCCCGAGG - Intronic
930562899 2:52983002-52983024 TAGGGCTATCCGCATGCCTGCGG + Intergenic
943491646 2:188561491-188561513 TAGGGCCAACCTCATGCCTCTGG + Intronic
947801698 2:232932721-232932743 AAGGGCTTACTTCCTGGCTGCGG + Intronic
948437116 2:237961295-237961317 CATGGCTAAGGTCTTGCCTGGGG + Intergenic
948597451 2:239089283-239089305 TAGCACTAATGTCTTGCCTGTGG - Intronic
1170214096 20:13873851-13873873 GAGGGCAAAGGTCCTGCCAGGGG - Intronic
1173663322 20:44749107-44749129 AAGGGCTAACTTCCTAACTGTGG + Intronic
975545261 4:75554385-75554407 TAGGACTAACATCAAGCCTGAGG + Intergenic
975662311 4:76699858-76699880 AAGGGCTAACATCCTGCATCAGG - Intronic
985862058 5:2478790-2478812 GAGAGCGAACGTCATGCCTGGGG + Intergenic
986600491 5:9467783-9467805 TGGGTCTGGCGTCCTGCCTGCGG + Intronic
997573168 5:134949101-134949123 TGGGGCTAAAGGCCTGCTTGAGG - Intronic
1001044433 5:168361029-168361051 TAGGGCTGCAGGCCTGCCTGGGG + Intronic
1001967156 5:175918662-175918684 GAGGGGAAACGTCTTGCCTGAGG - Intronic
1002249779 5:177920550-177920572 GAGGGGAAACGTCTTGCCTGAGG + Intergenic
1004557402 6:16712770-16712792 TAGGGCTAACGTCCTGCCTGTGG + Intronic
1022471396 7:30683616-30683638 GAGGGCAAGCATCCTGCCTGGGG - Intronic
1029284273 7:99455328-99455350 TAGGGCTAACATGATGGCTGGGG - Intronic
1035776780 8:2194139-2194161 TGGGGCTAAGGGCCTGGCTGGGG + Intergenic
1037189287 8:16101720-16101742 AAAGGCTACAGTCCTGCCTGGGG + Intergenic
1042873263 8:73417273-73417295 TGGGGCAAACCTTCTGCCTGGGG - Intergenic
1197727867 X:129788271-129788293 TAGGGCTAAGGACATGGCTGGGG + Intronic