ID: 1004559257

View in Genome Browser
Species Human (GRCh38)
Location 6:16731783-16731805
Sequence ACCACAGAGAATGCCAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004559257 Original CRISPR ACCACAGAGAATGCCAGTGT AGG (reversed) Intronic
900195109 1:1371995-1372017 ACTACAGAGGGTGCCAGTGGTGG + Intergenic
904074742 1:27831349-27831371 GCCACAGAGAATACGAGGGTAGG + Intronic
904136355 1:28315622-28315644 TCCACAAATAATGCCAATGTGGG + Intergenic
905541079 1:38760915-38760937 AACACAGATACTGCCTGTGTTGG - Intergenic
908562297 1:65318947-65318969 AAGACAGAGCATGCCAGTGGAGG + Intronic
909471770 1:76037193-76037215 GCCACGGAGGATGACAGTGTGGG - Intergenic
911462123 1:98204194-98204216 AATACAGAGAGAGCCAGTGTAGG + Intergenic
911620198 1:100057840-100057862 ACAACAGAGAATGGGAATGTGGG - Intronic
913693236 1:121299663-121299685 ACCACAGAGGCTGCCAGGGAGGG - Intronic
914144320 1:144980417-144980439 ACCACAGAGGCTGCCAGGGAGGG + Intronic
914711431 1:150217514-150217536 ACCACAGATAATACAAGTATAGG + Intergenic
915432924 1:155880550-155880572 GGCACAGAGAATGACAGTGGTGG + Exonic
920174253 1:204090204-204090226 AGCACAGAGAATGTGTGTGTTGG + Intronic
920480558 1:206318032-206318054 ACCACAGAGGCTGCCAGGGAGGG - Intronic
921515664 1:216088065-216088087 ACCAACAAGAAGGCCAGTGTGGG - Intronic
921905691 1:220493458-220493480 AGCAAATAGAAAGCCAGTGTAGG - Intergenic
922786018 1:228282641-228282663 CACTCAGAGGATGCCAGTGTGGG + Intronic
924200116 1:241649855-241649877 AACCCTGAGCATGCCAGTGTTGG - Intronic
924472117 1:244351748-244351770 ACTGTAGATAATGCCAGTGTTGG + Intergenic
1065585327 10:27211995-27212017 AACAGAGAGAAGGCCAGGGTGGG + Intronic
1068131438 10:52900499-52900521 ACCACACAGAATGACAGTTACGG + Intergenic
1069827352 10:71262331-71262353 ACCACAGTGGAGGCCTGTGTAGG + Intronic
1071675992 10:87656774-87656796 TATACAAAGAATGCCAGTGTTGG - Intergenic
1075882627 10:125866811-125866833 ATCCCAGATGATGCCAGTGTGGG + Intronic
1076363686 10:129908592-129908614 AACTCAGACAAAGCCAGTGTCGG + Intronic
1077472252 11:2769546-2769568 CCCGCAGAGAATGCCATTGATGG + Intronic
1077647740 11:3940752-3940774 CCCACAGAGAATGTCAATCTAGG + Intronic
1083505079 11:63149031-63149053 AACACAAAGAAGGCCAGTATGGG - Intronic
1083900454 11:65640912-65640934 CCCACAGAGCATGCCCATGTGGG + Exonic
1085732957 11:79014732-79014754 ACCACAGAGAAAGCCGGTTCTGG + Intronic
1085759156 11:79226969-79226991 ACAGCAGAGCAGGCCAGTGTGGG - Intronic
1086941371 11:92801672-92801694 ACCACAGAGAAGGTGAATGTGGG - Exonic
1087623595 11:100570052-100570074 TCCTCAGAGCATGCCAGTGGTGG - Intergenic
1090867320 11:130713234-130713256 TCCCCAGAGAGAGCCAGTGTGGG + Exonic
1090923624 11:131230533-131230555 ACCTCAGAGAATGCCAAGGTAGG - Intergenic
1091151803 11:133335890-133335912 ACCACAGAGAACAACAGTGATGG + Intronic
1092165803 12:6341617-6341639 ACCTCAGCCACTGCCAGTGTGGG - Intronic
1092667279 12:10816555-10816577 AACACAGAGAATGGCAGTTGTGG + Intergenic
1095119383 12:38397811-38397833 AACACAGAGGAAGGCAGTGTTGG - Intergenic
1095741517 12:45611495-45611517 ACCACAGAGCAAGCCAGAGGAGG - Intergenic
1098041625 12:66358939-66358961 CCCACAGATAAAGCCAGAGTGGG - Intronic
1099475027 12:83097860-83097882 AGCAGACAGAATGCCAGTGTTGG + Intronic
1100197226 12:92260561-92260583 TTCAGAGAAAATGCCAGTGTTGG - Intergenic
1102444876 12:112994330-112994352 ACCACATAGAAAGCCAATGGCGG - Intronic
1102576158 12:113857421-113857443 GGCACAGGGAAGGCCAGTGTGGG + Intronic
1104455937 12:128912086-128912108 GCCAGAGAGCATGCCAGTGCCGG - Intronic
1106003944 13:25751110-25751132 ACCACAGAGAATCTCCTTGTAGG - Intronic
1106241040 13:27913912-27913934 ACCACAGACAATGCTAGTGGGGG + Intergenic
1108270885 13:48758449-48758471 AGCCCACAGATTGCCAGTGTAGG + Intergenic
1108568655 13:51728042-51728064 GCACCAGAGAAAGCCAGTGTTGG + Intronic
1113560227 13:111272821-111272843 ACCTCAGAGATCGCCAGTGAAGG + Intronic
1116125248 14:40775653-40775675 ACCACAGGGAAGGCCATTATAGG + Intergenic
1117895572 14:60482363-60482385 AACACTGACAATTCCAGTGTTGG + Intronic
1120543450 14:85780164-85780186 TCCACAAAGAATGCCTATGTAGG + Intergenic
1121947247 14:98135354-98135376 ACCCCAGAGAGTGCCAGCTTTGG - Intergenic
1124680846 15:31729570-31729592 ACCACATGGAATGCCCGTGAAGG - Intronic
1126888333 15:53176276-53176298 ATCTCAGTGAATGCCACTGTGGG + Intergenic
1126969817 15:54098215-54098237 ACCACAGAGCATTCCAGCCTGGG - Intronic
1127892374 15:63265710-63265732 ACCACAGAATATGTCAGTTTTGG - Exonic
1128807494 15:70541892-70541914 CCCACAAAGAAAGCCAGGGTAGG - Intergenic
1129077190 15:73007395-73007417 ACCACAGACAATGGCAGAGGAGG - Intergenic
1129937211 15:79460654-79460676 ACCACAGAGAGTGGCATTTTAGG - Intronic
1131122827 15:89833739-89833761 AGCACAGAGATGGGCAGTGTGGG - Exonic
1132283517 15:100641930-100641952 ATCACAGAGACTGCAAGTGGTGG + Intronic
1135054379 16:19218810-19218832 AACAAAGAGAAGGCCAGTGTGGG - Intronic
1137239774 16:46646134-46646156 ACCACAGAAAAAGGCAGTGGGGG + Intergenic
1137483717 16:48874354-48874376 GCCATAGAGCATGCCAGTGGGGG + Intergenic
1137960931 16:52881531-52881553 ATCAGAGAGGAGGCCAGTGTGGG - Intergenic
1139777663 16:69326792-69326814 TCCACAGTGAAAGCCAATGTAGG - Exonic
1141619934 16:85231958-85231980 ACCGCCATGAATGCCAGTGTTGG + Intergenic
1141755271 16:85986935-85986957 CTCACAGAGAGTGTCAGTGTTGG - Intergenic
1144146568 17:12404776-12404798 AGCATAAAGAAAGCCAGTGTTGG + Intergenic
1144353992 17:14426975-14426997 ACCACAGAGAATGCTGAAGTGGG - Intergenic
1145000857 17:19303629-19303651 ACCACCGATAGTGCCAGCGTTGG + Intronic
1146091899 17:29887656-29887678 AGCACAGAGTAAGCCAATGTTGG + Intronic
1146486615 17:33248267-33248289 AACAGTGAGAAGGCCAGTGTAGG + Intronic
1148753045 17:49956900-49956922 AACCCAGAGAATTCCAGAGTCGG + Intergenic
1150290825 17:63980587-63980609 ACCACAGAGAAAGACAATGCAGG - Intergenic
1150411184 17:64941821-64941843 TATACAGAGAATGACAGTGTAGG + Intergenic
1154297506 18:13163233-13163255 ACGACAGAGAATGCCAGGAAGGG + Intergenic
1155455821 18:26012098-26012120 ACTCCAGAGAATGACAGTGTAGG - Intergenic
1156285038 18:35684599-35684621 ACCACAGTGACTTCCAGTTTGGG + Intronic
1158096914 18:53783344-53783366 ACCATACAGAAAGCCAGTGCTGG + Intergenic
1159524451 18:69569211-69569233 ACCAAAGAGAATGCTAGAGAAGG + Intronic
1160760325 19:780939-780961 ATAACATAGAATTCCAGTGTGGG - Intergenic
1164551939 19:29219277-29219299 ACCACTGAGAAGGCCAGAGGTGG - Intergenic
1165329077 19:35131472-35131494 CCCACCGTGAATGCCAGCGTGGG - Exonic
1165378119 19:35458048-35458070 GCCAGAGAGAAGGCCAGTGAAGG + Intergenic
1168104518 19:54158531-54158553 ACCACAGAAAATGGCAGTCCAGG + Intronic
925643067 2:6005962-6005984 AACACTGAGTATGCCAGTTTTGG - Intergenic
926438147 2:12858492-12858514 ACCACAGAAAAAGGAAGTGTTGG + Intergenic
926689930 2:15726071-15726093 ACAACAGAGACAGACAGTGTGGG - Intronic
927512501 2:23653144-23653166 ACCATAGTGAATGTCAGAGTAGG + Intronic
927823686 2:26292070-26292092 AAGACTGAGAATACCAGTGTTGG + Intergenic
929437385 2:41939002-41939024 GGCAGAGAGAAGGCCAGTGTAGG - Intronic
929933662 2:46277626-46277648 ACCACAGAAAATGGCAGGCTCGG + Intergenic
930096310 2:47569682-47569704 ATCACAGAGCCGGCCAGTGTTGG + Intronic
930718864 2:54619700-54619722 GCCAGAAAAAATGCCAGTGTAGG - Intronic
932414546 2:71565678-71565700 AGCACAGAGGATGCCAGGGCTGG + Intronic
932563209 2:72889950-72889972 ACATCAGAGAATTCCAGGGTTGG - Intronic
932620354 2:73261386-73261408 AACCCAGAGAATGCCAATGGTGG - Intronic
934513532 2:94968295-94968317 ACCCCCGACAATGCCTGTGTTGG - Intergenic
935335012 2:102008065-102008087 GCCACAGAGAATGACAGGGAAGG + Intronic
937162557 2:119778836-119778858 ACATCAGTGAATCCCAGTGTAGG + Intronic
937213258 2:120291981-120292003 ATGACAGAGACTGCAAGTGTGGG - Intronic
937590583 2:123608545-123608567 AGCACAGACAATGCAAGTGCAGG + Intergenic
937913449 2:127087473-127087495 ACCCCAGAGGAAGCCAGGGTGGG + Intronic
938472686 2:131579995-131580017 ACCACAGTGCTTGCCAGGGTTGG - Intergenic
938618340 2:133022566-133022588 ATCACAGAGAAAACCAGAGTTGG + Intronic
943139457 2:183961710-183961732 AACAGCCAGAATGCCAGTGTTGG - Intergenic
944644720 2:201767289-201767311 ACCAGAGAGATTGCCAGGCTGGG - Exonic
945200725 2:207278281-207278303 ATCACAGGGAAAGCCATTGTGGG - Intergenic
945563588 2:211368547-211368569 ACCAGAGAGAATGCCAGAGAGGG + Intergenic
945728186 2:213499664-213499686 TGCACAGAGAATGCCAGTTATGG - Intronic
946427704 2:219608273-219608295 ACCACAGAAAATGTCAGAGGAGG + Exonic
947876425 2:233470813-233470835 CCCAAAGAGAAGGACAGTGTTGG + Exonic
947876433 2:233470864-233470886 CCCAAAGAGAAGGACAGTGTTGG + Exonic
948310358 2:236981231-236981253 GTCACAGAAAATGCCAGTGAAGG + Intergenic
948422106 2:237865930-237865952 ACCAGAGAGCATGCCTGTGTAGG + Intronic
1170479509 20:16752195-16752217 ACCTTAGAGAATGAAAGTGTGGG + Intronic
1172292620 20:33787397-33787419 ACCACAGAGCATTCTATTGTAGG + Intronic
1173374031 20:42466993-42467015 ATCACAGAGAATGGCAGTAGAGG + Intronic
1175518757 20:59586136-59586158 ACCACAGAGCAGGCCAGGGCAGG - Intronic
1175630840 20:60535129-60535151 ACCCCAGAGACTGGCAGTGGGGG + Intergenic
1175867398 20:62186827-62186849 TCCACAGAGAATCCCAGGGAAGG - Intronic
1178022936 21:28430707-28430729 GCCACACTGAATGCCAGGGTGGG - Intergenic
1178716309 21:34967697-34967719 AGCTCAGAGGATCCCAGTGTTGG - Intronic
1178942068 21:36914701-36914723 ACCAAAGAGAAAGCCAGGGTTGG + Intronic
1181315544 22:21968677-21968699 TCCACACAGAATCCCAGGGTTGG + Exonic
1184080985 22:42220111-42220133 AGGACAGAGAAAGCCAATGTTGG - Intronic
950029108 3:9840292-9840314 ACCACAGACAGTTCCAGTGAAGG - Exonic
952581692 3:34840941-34840963 ACCAAAGAGAAAGACATTGTTGG + Intergenic
952853114 3:37745065-37745087 ACAGCAGTGAATGCCAGAGTGGG - Intronic
953123682 3:40070910-40070932 ACCACATAGAATGCCCTTGCTGG - Intronic
953852530 3:46477155-46477177 AAGACAGACAATGGCAGTGTTGG - Intronic
955224074 3:57047017-57047039 ACAACAGAGAAAGCCAATGGAGG + Intronic
956658021 3:71570814-71570836 ACCATAGAGAAGGCCACTGCTGG + Intronic
957130112 3:76213825-76213847 AACACAGAGAATAGCAATGTTGG + Intronic
957294720 3:78322360-78322382 AGCACAAAGAATGCTGGTGTTGG - Intergenic
958907068 3:99953901-99953923 ACCACAGAGCAGGTCAGTGTGGG - Intronic
959131408 3:102361201-102361223 ACCAGGAAGAATGCCATTGTGGG + Intronic
959248701 3:103910797-103910819 ACCGCACAAAAGGCCAGTGTTGG + Intergenic
959490580 3:106983760-106983782 ACCACATAGAATTCCACTGTTGG + Intergenic
960292263 3:115900108-115900130 ACATCAGAGAATTTCAGTGTGGG + Intronic
961154612 3:124668422-124668444 ATCACAGAGCATGCCAGCATGGG - Intronic
961951088 3:130749856-130749878 AACAAAGAGAAAGCCAGTGTGGG - Intergenic
962312732 3:134337590-134337612 ACCACAGGGCATGGCACTGTAGG + Intergenic
964069722 3:152616868-152616890 ATCAGAGAGAATGCTAGTTTGGG + Intergenic
964349918 3:155792054-155792076 ACCAAATACAATCCCAGTGTTGG + Intronic
965299200 3:166988981-166989003 ACCAGTCAGAAAGCCAGTGTGGG + Intergenic
969516314 4:7650145-7650167 ACCACAGATAATTCAAGTGCAGG + Intronic
969927385 4:10597685-10597707 ACCCCAGAGAGAGCCAGTGATGG - Intronic
970000629 4:11362533-11362555 ACCACAGACAGTGCCAGAGAGGG - Intergenic
972802967 4:42496599-42496621 ACCACAGAGAAAGCTAATGTTGG + Intronic
976084470 4:81393466-81393488 AGAACAGAGAATTACAGTGTTGG + Intergenic
976150965 4:82091156-82091178 AGGACTGAGAATGCCAGAGTGGG + Intergenic
977316789 4:95460127-95460149 CCCACAGACAATCCCAGTGGAGG - Intronic
978632864 4:110767337-110767359 AGCACAGAGAGGGTCAGTGTTGG - Intergenic
983020774 4:162673277-162673299 TACAGAAAGAATGCCAGTGTAGG + Intergenic
983527217 4:168771549-168771571 TCCCCAGAGATTGCCAGTCTGGG + Intronic
983692603 4:170490351-170490373 TCGACAGAGAATGCCCTTGTTGG - Intergenic
984465083 4:180089064-180089086 AACACAGAGAAGCCCTGTGTTGG + Intergenic
985213908 4:187628853-187628875 ACCCCAGAGAAACCCAGTGCTGG + Intergenic
986023151 5:3823501-3823523 AGCACTGAGAGTGCCACTGTGGG + Intergenic
990295508 5:54397838-54397860 ACAACAGAGAATAACTGTGTGGG - Intergenic
995698934 5:114911946-114911968 AAGACAGAGATTGCCAGAGTGGG + Intergenic
997436715 5:133880937-133880959 CCCCCAGAGAATCCCACTGTAGG + Intergenic
998174437 5:139893096-139893118 AACAGAGAGAAAGCCACTGTAGG + Intronic
998741170 5:145203629-145203651 ACCACAGTGAATGACACAGTGGG + Intergenic
999842209 5:155440003-155440025 AGCACTTAGAATGCCAGAGTTGG - Intergenic
1001104632 5:168842761-168842783 AGCACAGAGAATGACCGTGAGGG + Intronic
1001295162 5:170494043-170494065 ACCCCAGGGACTGGCAGTGTGGG + Intronic
1002874951 6:1202491-1202513 ACCTGGGAGAATGCCAGCGTGGG - Intergenic
1004559257 6:16731783-16731805 ACCACAGAGAATGCCAGTGTAGG - Intronic
1006062204 6:31432103-31432125 ACCAGTCAGCATGCCAGTGTGGG - Intergenic
1006440838 6:34052701-34052723 ACCACAGAGCATGCCTGGGCTGG + Intronic
1008619161 6:53254907-53254929 ACCACAGAGAATGGGAGAATTGG - Intergenic
1012503794 6:99921103-99921125 CCCACATAGAAGGCCAGTGTGGG + Exonic
1015137666 6:129891736-129891758 GCCACAGAGTATTCCAGCGTAGG - Intergenic
1016939319 6:149471407-149471429 AGCACAGAGAATGTGAGAGTGGG - Intronic
1018788224 6:167125462-167125484 ACCACAGAGCCAGCCAGTATTGG + Intronic
1020265590 7:6557845-6557867 TCCACAGAGAATGCCGCAGTGGG + Intergenic
1021416376 7:20390522-20390544 ACCACAAAGAGTGCCACAGTTGG + Intronic
1021928713 7:25558264-25558286 AGCATTGAGAATGGCAGTGTGGG + Intergenic
1023288674 7:38646215-38646237 AAAAAAGAGAATGCCAGGGTGGG - Intergenic
1024154117 7:46603036-46603058 ACCAGAGAGAAGGCCTGTGTGGG + Intergenic
1024585784 7:50841190-50841212 TTCACTGAGAATGGCAGTGTAGG + Intergenic
1025246768 7:57323408-57323430 CCCACAGGGACTGGCAGTGTGGG + Intergenic
1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG + Intronic
1027693783 7:81382504-81382526 GCCACAGAGAATGGAACTGTGGG + Intergenic
1029321301 7:99762929-99762951 ACCACAAAGAATCCCAATTTTGG + Intronic
1030083246 7:105795740-105795762 ACCATAGAGAATCCCACGGTCGG + Intronic
1031449958 7:121903634-121903656 AGCACAAAGAATGCCATTGCAGG - Intronic
1033145790 7:138869180-138869202 ACCACAGAAGGAGCCAGTGTGGG + Intronic
1034036847 7:147833812-147833834 AGCACAGGGACTGGCAGTGTAGG - Intronic
1034059480 7:148073313-148073335 ACCACAGAAAATGAAACTGTAGG - Intronic
1034087529 7:148333837-148333859 ACAGCAAGGAATGCCAGTGTTGG + Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034754246 7:153600209-153600231 ATCACAGAAAATGGCAGAGTAGG + Intergenic
1035567159 8:649460-649482 AGCACAGAGAATTCCAGGGTGGG + Intronic
1037208000 8:16348219-16348241 ACCAGAGAGAAAGCCACTGCAGG + Intronic
1038255806 8:25949879-25949901 ACCACACAGGATGACAGTTTTGG + Intronic
1041041182 8:53847636-53847658 AAGACAGACAATGACAGTGTTGG - Intergenic
1043404706 8:79918413-79918435 ACCACGGAGGAAGCCACTGTAGG - Intergenic
1044316463 8:90754355-90754377 ACCACAGAGAATGTCACAGTAGG + Intronic
1044532684 8:93325573-93325595 AAAACAGAGAATTCTAGTGTCGG - Intergenic
1044624657 8:94225462-94225484 GCAGCAGAGAATGCCAATGTTGG + Intergenic
1045139372 8:99263256-99263278 TCCATAGAGAAAGTCAGTGTTGG + Intronic
1045615233 8:103901199-103901221 ATCATTGAGAATACCAGTGTTGG - Intronic
1045648464 8:104321723-104321745 ACCACAGAAAAAGCCAGTAGAGG - Intergenic
1046427597 8:114075443-114075465 AACAGAGAGGATGCCATTGTGGG - Intergenic
1046500599 8:115071495-115071517 ACCACAGAGGAGGCCAGTACTGG + Intergenic
1048599782 8:135907355-135907377 GGCACAGAGATTGGCAGTGTAGG - Intergenic
1050961129 9:11733502-11733524 ACCAGAGAGAATGGCAGAATAGG + Intergenic
1056839334 9:89985992-89986014 TCCACAGAGAAGGCAATTGTAGG + Intergenic
1057066309 9:92055235-92055257 ACAACACTGAATGCCAGTGCTGG - Intronic
1057367160 9:94433249-94433271 GCCACAGTGGCTGCCAGTGTGGG - Intronic
1057656174 9:96954821-96954843 GCCACAGTGGCTGCCAGTGTGGG + Intronic
1058650851 9:107174655-107174677 ACCACAGAGGCTGCCTGTGCCGG - Intergenic
1061187519 9:129063423-129063445 GCCACAGAGGAGCCCAGTGTGGG - Intronic
1061551460 9:131337131-131337153 ACCACAGAGGATGTTAGTGTTGG - Intergenic
1061630063 9:131866690-131866712 ACCACAGGGGATGACAGTGAGGG + Intronic
1186164395 X:6811282-6811304 CCCACAGAGAATGGCACTGGTGG - Intergenic
1187210365 X:17224513-17224535 ACCACAGAGAATGGAACTTTTGG + Intergenic
1187417286 X:19104207-19104229 ACCACAGAGAAACTCAGTGAGGG + Intronic
1187444386 X:19347902-19347924 AACACAGACAATGACAGTGCTGG - Intronic
1187637851 X:21251989-21252011 AGGACAGAGAATGTTAGTGTTGG + Intergenic
1187740359 X:22349013-22349035 ACCACAGAGAATAAGAGTGATGG + Intergenic
1188307504 X:28576171-28576193 ACAACAGAGCCTGCCAGTATCGG - Intergenic
1188524396 X:31073158-31073180 AACAAAGACAATGACAGTGTTGG - Intergenic
1192250741 X:69411452-69411474 CCCACAGAGAACCCCAGTCTGGG + Intergenic
1193667556 X:84340930-84340952 ATGACAAAGAATGTCAGTGTAGG + Intronic
1195826525 X:109007006-109007028 AAGACAGAGATTGTCAGTGTGGG + Intergenic
1195990557 X:110678149-110678171 AGGCCAGAGAATGCCAGTGGAGG - Intronic
1196723089 X:118873035-118873057 GCCACAGAGAATCTCAGTGTGGG - Intergenic
1199391038 X:147279227-147279249 ACGACAGACAATGGCACTGTGGG - Intergenic
1199391256 X:147281918-147281940 ACGACAGACAATGGCACTGTGGG - Intergenic
1199391474 X:147284616-147284638 ACGACAGACAATGGCACTGTGGG - Intergenic
1200022207 X:153221656-153221678 TCCCCAGAGAATGGCATTGTGGG + Intergenic
1200912519 Y:8543698-8543720 AACACAGAAGTTGCCAGTGTGGG - Intergenic
1200919325 Y:8599149-8599171 ACCACAGAGACTGCCAGAAGGGG + Intergenic
1201566077 Y:15366605-15366627 AGCACAGAGAATGGCAGAGAGGG - Intergenic
1202054633 Y:20817232-20817254 AGCACACAGAATGGCAATGTTGG + Intergenic