ID: 1004560084

View in Genome Browser
Species Human (GRCh38)
Location 6:16741299-16741321
Sequence CTGGATAACTGTGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004560082_1004560084 -9 Left 1004560082 6:16741285-16741307 CCACTGCACATGGTCTGGATAAC 0: 1
1: 0
2: 2
3: 23
4: 291
Right 1004560084 6:16741299-16741321 CTGGATAACTGTGGTTTTAAAGG 0: 1
1: 0
2: 2
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004560084 Original CRISPR CTGGATAACTGTGGTTTTAA AGG Intronic
904133610 1:28293746-28293768 CTGTATAAATTTGGTTTGAAAGG - Intergenic
904133927 1:28296419-28296441 CTGGATAACTCTGTGTTCAAAGG - Intergenic
904218822 1:28947524-28947546 CTGAATAACTGTATTTTTAACGG - Intronic
905026632 1:34854949-34854971 CAGGATAACATTGGTATTAAAGG - Exonic
908071962 1:60470525-60470547 CTGGAAAACTTTTGTTTTAGTGG - Intergenic
908206428 1:61855057-61855079 CTGGATTTGTGTGGTTTTATAGG + Intronic
910063875 1:83128618-83128640 CTTGATTACTGTAGTTTTATAGG - Intergenic
910533635 1:88270670-88270692 CTGGAGAATTCTGGTTTTAAAGG - Intergenic
912062479 1:105689679-105689701 CTTAATAACTGGGATTTTAAGGG + Intergenic
913940490 1:125099193-125099215 CTAGAGAACTGTGGGATTAACGG + Intergenic
913944131 1:125141683-125141705 CTAGAGAACTGTGGGATTAACGG - Intergenic
915863605 1:159474532-159474554 CTTGAGAACTGTAGTTTCAAGGG - Intergenic
915886193 1:159723567-159723589 CAGGATAACAGTGATTTTCAGGG - Intergenic
916434023 1:164759951-164759973 CTTTACAACTGTGGTTTTTAGGG - Intronic
916966941 1:169957349-169957371 CTTTATAACTGTGGTCTAAAAGG - Intronic
917799801 1:178560351-178560373 CTGGAAGATTGTGGGTTTAAGGG - Intergenic
918382170 1:183967154-183967176 CTTGACAACTGTGGATTTTAAGG - Intronic
918518472 1:185388363-185388385 ATGGATAACTATGGTTGGAAAGG - Intergenic
918556967 1:185814195-185814217 CTGTACAACTATTGTTTTAAGGG - Intronic
918583220 1:186157001-186157023 CTGGGTATCTGTGTTTTTAATGG - Intronic
919064785 1:192680320-192680342 CTGGAAGACTGTGACTTTAAAGG - Intergenic
920266106 1:204724293-204724315 CTGGAAATTTGAGGTTTTAAGGG + Intergenic
920747359 1:208641676-208641698 CTGGATAACAGTTATTCTAAAGG + Intergenic
921243625 1:213213445-213213467 CTTGATTACTGTGGCTTTATAGG + Intronic
923183916 1:231550834-231550856 CCTGATAACTGTCATTTTAATGG + Intronic
924092771 1:240519425-240519447 TTGGAAAACGGTGGTTATAAAGG - Intronic
1063880915 10:10531197-10531219 TTGAGAAACTGTGGTTTTAAAGG - Intergenic
1064405053 10:15054162-15054184 CTGGGTAACTGGGATTTTACAGG + Intronic
1065196816 10:23274618-23274640 CAGGATAACAGTGATTTTCAGGG - Intronic
1066007606 10:31160363-31160385 CTGGATAACTCTGGGTTGTATGG + Intergenic
1066167674 10:32805711-32805733 CTGGATGACAGTGGTTTTAGAGG - Intronic
1066171068 10:32847080-32847102 TTGGATAACATTGGTTTTAGAGG - Intronic
1066215265 10:33280312-33280334 CTGGAACACAGTTGTTTTAAGGG - Intronic
1066621253 10:37353855-37353877 CAGGATAACAGTGATTTTCAGGG + Intronic
1068071722 10:52204823-52204845 CAGGATAACAGTGGTTTTCAGGG + Intronic
1068152833 10:53156048-53156070 CAGGATAACAGTGATTTTCAGGG - Intergenic
1070652789 10:78250024-78250046 CTGGATAATTCTGTTTTTAGAGG - Intergenic
1071089176 10:81898860-81898882 ATGTATAACTGTGGTTATACAGG + Intronic
1076602433 10:131667501-131667523 CTGGAAAACTTTAGCTTTAAGGG + Intergenic
1078013242 11:7590370-7590392 CTGGAGAACGGTGATTTTGAAGG + Intronic
1080550941 11:33373838-33373860 CTGGACAATTGTGGTGTTGATGG - Intergenic
1082154961 11:48798179-48798201 CTGGAGGCCTGTGGTATTAAAGG - Intergenic
1082574090 11:54781646-54781668 CAGGATAACCGTGATTTTCAGGG + Intergenic
1085430997 11:76447934-76447956 TTAGATATCTGTGATTTTAAAGG + Intronic
1086589794 11:88499961-88499983 GTCGATGACTTTGGTTTTAATGG + Intergenic
1088720583 11:112588701-112588723 CTGGAGAGCTGTGGCTTAAAAGG - Intergenic
1089400517 11:118161662-118161684 CTTGATATTTGTGGTTCTAATGG - Intergenic
1093044829 12:14431097-14431119 GTAGAAAACTGTGTTTTTAAAGG - Intronic
1093092092 12:14933461-14933483 CTGGATAAATGTAGTTTTAATGG + Intronic
1093115906 12:15210838-15210860 CTGGTTACCTGTGGCTTTACAGG - Intronic
1093281248 12:17198959-17198981 CTAGATAACTGTGGAAATAAAGG - Intergenic
1094055649 12:26266978-26267000 CTGGAAAAGTTTGGTTTTCAAGG + Intronic
1094686889 12:32726262-32726284 CTGGGTAATTTTTGTTTTAAAGG - Intronic
1094740406 12:33281994-33282016 CAGGATAACAGTGATTTTCAGGG - Intergenic
1095358877 12:41311454-41311476 CTGAATATCTGTAATTTTAAAGG + Intronic
1098038142 12:66327209-66327231 CTGGGGAACTTTGGTCTTAAGGG - Intronic
1098839168 12:75458356-75458378 CAGGATAACAGTGATTTTCAGGG - Intergenic
1100671076 12:96813682-96813704 ATGGATGACTGTAGGTTTAAAGG - Intronic
1102210102 12:111120406-111120428 CCGGCTATTTGTGGTTTTAAGGG - Intronic
1102326723 12:111992068-111992090 TGGGATAACTGTGGTTATAGTGG - Intronic
1106277922 13:28232376-28232398 CTAAAAAACTGTTGTTTTAATGG + Intronic
1106356252 13:28986275-28986297 CTGGATGACAGTGGTCTTGAGGG + Intronic
1106677796 13:31979455-31979477 TTGGATAACAGTGGATTTAAAGG - Intergenic
1107761098 13:43679746-43679768 CTGGATAAGTGAGGTATTAGAGG + Intronic
1108799064 13:54070373-54070395 CAGGATAACAGTGATTTTCAGGG - Intergenic
1110689976 13:78421604-78421626 CTGGATATATGTGGTTATATAGG - Intergenic
1111962764 13:94829393-94829415 CTGGATAATTGCGGTTTAATTGG + Intergenic
1112157216 13:96831182-96831204 CAGGACATCTGTGGTTTAAAAGG - Intronic
1114788008 14:25623255-25623277 TTGGTTAACTTTGGTTATAAAGG - Intergenic
1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG + Intronic
1119344074 14:73907431-73907453 CTGGCTAACTGTATTTTTAGTGG - Intronic
1120156092 14:81095069-81095091 GTAGATTACTGTGGTTTTCAAGG + Intronic
1122539131 14:102487176-102487198 CTGGATAACCGTGGTTTGTTTGG + Intronic
1123166111 14:106326676-106326698 CTGTAGAACAGTGGTTTTGATGG - Intergenic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1124848837 15:33316501-33316523 CTGGATAAATCTTGTATTAAGGG - Intronic
1129210918 15:74067605-74067627 CTTGAAAACTGTGGTGTTAAAGG - Intergenic
1129403093 15:75297739-75297761 CTTGAAAACTGTGGTGTTAAAGG + Intergenic
1130357313 15:83145325-83145347 ATGGCTAACCGTGGTTTTCAGGG - Intronic
1130569168 15:85025248-85025270 CTGGATCACTTTGCTTTTAAGGG + Intronic
1135505537 16:23032938-23032960 CAGAATAACAGTGGCTTTAAAGG + Intergenic
1135849696 16:25952204-25952226 CTGGAAAACTGTTTCTTTAAAGG - Intronic
1136250305 16:28999998-29000020 CTGGCTCACTGTGGTGTTGAGGG + Intergenic
1139408896 16:66742853-66742875 CTATATTACTGTAGTTTTAAAGG - Intronic
1144535586 17:16086655-16086677 CTTGAAAGCTGTGGTTTGAAAGG - Intronic
1145801270 17:27686920-27686942 CGGGATAACAGTGATTTTCAGGG - Intergenic
1147475671 17:40709539-40709561 TTAGATAACTGTGGTATAAAGGG + Intergenic
1147811355 17:43171964-43171986 CTGGATAACTTGGCTTGTAAAGG + Intronic
1150345151 17:64398827-64398849 CTGGTTAAATGTGCTTTCAAAGG - Intronic
1151063263 17:71121369-71121391 CTGAATAAATGAGTTTTTAAAGG + Intergenic
1151289502 17:73139326-73139348 CTAGATAACAGTGGTCTTCAAGG - Intergenic
1152200471 17:78942959-78942981 CGGCATAACTATGTTTTTAAAGG + Intergenic
1153472440 18:5462147-5462169 CTGCATAATTGTGATTTTTAAGG - Intronic
1154099235 18:11454273-11454295 TTGGCCAACTCTGGTTTTAAAGG + Intergenic
1155296396 18:24388375-24388397 CTGGATTACTTTGTTTTCAAAGG - Intronic
1156650375 18:39218852-39218874 CTTGATCCCTGAGGTTTTAATGG + Intergenic
1156883862 18:42111937-42111959 CAGGATAACAGTGATTTTCAGGG + Intergenic
1160139209 18:76305431-76305453 CTGGATAATTGTAGCTTTATAGG + Intergenic
1164221133 19:23195064-23195086 CGGGATAACTGTGGTTTGTTTGG - Intergenic
1164923083 19:32104213-32104235 CTGGAGAGCTGTAGTTTTGAGGG - Intergenic
1165430596 19:35769685-35769707 CTGGTTAACTGTGGGTGGAAGGG - Intronic
1165871272 19:38975385-38975407 TTGTATAACTTTGGGTTTAAAGG + Intronic
1166912571 19:46170505-46170527 CAGGATAACAGTGATTTTCAGGG + Intergenic
926269592 2:11355180-11355202 CTGGCTAATTGTGTTTTTAGTGG - Intergenic
926498920 2:13628127-13628149 AAGGATCACTGTGGTTTTACTGG - Intergenic
928652308 2:33416190-33416212 CTTGATAACTTTGGATTTGAAGG + Intergenic
929976834 2:46643255-46643277 CAGGATAACAGTGATTTTCAGGG - Intergenic
929978266 2:46655560-46655582 TTTGTTAACTGTGATTTTAAAGG + Intergenic
931936009 2:67197220-67197242 CATGATAAGTTTGGTTTTAAAGG - Intergenic
932690995 2:73913632-73913654 CTGGATACCTGTGGTCACAAAGG - Exonic
935191537 2:100782353-100782375 CTGGATGGCTGTGGGTTTGAAGG - Intergenic
935787042 2:106558783-106558805 TTGCATAACTGTGGTATTATGGG + Intergenic
937360245 2:121224640-121224662 TTGGACAACTGTGGTTCTCAGGG + Intronic
938616559 2:133005019-133005041 CAGGATAACAGTGATTTTCAGGG - Intronic
944028617 2:195204050-195204072 AGGGAGAACTGTGTTTTTAAAGG + Intergenic
946098671 2:217299734-217299756 CTGGATTATTCTGGTTTCAATGG + Intronic
946200159 2:218066897-218066919 CTTGATTACTGTTGCTTTAATGG + Intronic
947695940 2:232188877-232188899 TTGGATTGCTTTGGTTTTAAAGG - Intronic
1172188272 20:33045290-33045312 CAGGATAACAGTGATTTTCAGGG + Intergenic
1172678685 20:36695335-36695357 CTGGATAACAGTGATGTTCAAGG + Intronic
1177419569 21:20838849-20838871 CTGGAAGACTGTGGGTTTACCGG + Intergenic
1178881433 21:36453259-36453281 CTGGCTCATTGTAGTTTTAATGG + Intergenic
1182634743 22:31716742-31716764 TTAGAAAACTGTGGTTTTGAAGG - Exonic
1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG + Intronic
949240039 3:1859921-1859943 AGGGAAAACTGTGCTTTTAAAGG - Intergenic
951586553 3:24220842-24220864 CTGGGAAACTGTGGGTTAAATGG - Intronic
952063869 3:29543292-29543314 ATGGAGAATTGTGGTTTTATTGG - Intronic
952291814 3:32024094-32024116 CTTGATTACTGTCGTTTTAATGG + Intronic
953341441 3:42137564-42137586 CTTGATAACTTTGAGTTTAAGGG - Intronic
953523985 3:43671544-43671566 CTGTATAATTTTTGTTTTAAAGG + Intronic
955133279 3:56191224-56191246 GGGGAGAACTGTGGTTTTCAGGG + Intronic
955871093 3:63439329-63439351 ATGGATAAATGTTATTTTAAAGG + Intronic
956074235 3:65488046-65488068 CAGGATAGCAGTGGTTCTAAGGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956715506 3:72076256-72076278 CAGGATAACAGTGATTTTCAGGG - Intergenic
960996304 3:123342710-123342732 CTGGAGCCCTGAGGTTTTAAAGG - Intronic
963807282 3:149736363-149736385 GTGGATGCCTGTGGTTTTGAAGG - Intronic
964133734 3:153319837-153319859 CTGACTGACTGTGATTTTAATGG + Intergenic
964398912 3:156278344-156278366 CTGGTTCACTGTAGTTTTCAAGG + Intronic
967201317 3:187074819-187074841 CTTGATGACTGAGTTTTTAAGGG - Intronic
969489206 4:7489564-7489586 CTGGATATCTGTATTTTAAATGG + Intronic
970722369 4:19002641-19002663 CAGGATAACAGTGATTTTCAGGG - Intergenic
975580650 4:75904322-75904344 CAGGAGAACTGTGGTTTTCGAGG - Intergenic
976128497 4:81858551-81858573 CTGGAAGACTGTGGGTTTATGGG - Intronic
976483337 4:85570443-85570465 CTGGAGAAGAGTGGTTTAAAAGG + Intronic
976977338 4:91181064-91181086 CTGGAAGACTGTGGGTTTATGGG - Intronic
977686541 4:99853133-99853155 CTGGATAACTGTGGCTGGATTGG - Intronic
980106164 4:128590629-128590651 CTGTAGACCTGTGGTTTTAACGG - Intergenic
981753934 4:148120656-148120678 CTGGATATCTGTGGCTGAAAAGG - Intronic
982892635 4:160875457-160875479 CTGGTCAACTCTGGATTTAAAGG + Intergenic
983238928 4:165209146-165209168 CTCGATAGCTGTGGCTTTGAGGG + Intronic
985206723 4:187546165-187546187 CTGGATAAATGCGATTTTAGTGG - Intergenic
986092017 5:4518925-4518947 TTGGATAACTTTGCTTTAAAAGG + Intergenic
987978514 5:25047467-25047489 TGGGATGACAGTGGTTTTAATGG - Intergenic
988245543 5:28675649-28675671 CAGGATAACAGTGATTTTACGGG - Intergenic
989043964 5:37256447-37256469 CTGGATAACTGAGCTTTTAAAGG + Intergenic
990754380 5:59052261-59052283 AAGGAAGACTGTGGTTTTAATGG + Intronic
992859726 5:80898170-80898192 CTGGGTAACTGTGGATGTGATGG - Intergenic
992860362 5:80903027-80903049 CAGGATAACAGTGATTTTCAGGG - Intergenic
993047701 5:82887137-82887159 CAGGATAACTGTGGCTTCATGGG + Intergenic
993367280 5:87049443-87049465 CAGGATAACAGTGATTTTCAGGG - Intergenic
996128159 5:119750284-119750306 CTCAATAAATGTGGTTTGAATGG + Intergenic
996146887 5:119987477-119987499 CAGGATAACAGTGATTTTCAGGG - Intergenic
997491939 5:134284848-134284870 TAGGATAACAGTGGTTTTCAGGG - Intergenic
998033072 5:138890089-138890111 CAGGCCAACTTTGGTTTTAAGGG + Intronic
1000291501 5:159875558-159875580 CTGGAAAACTGGAGTTTTAGTGG - Intergenic
1000690190 5:164307966-164307988 CTTAGTAACTGTGGTTTTCAGGG + Intergenic
1001566090 5:172700437-172700459 CTGGATAAATGAGGGTGTAAAGG + Intergenic
1001573107 5:172743753-172743775 CTGGTTAATTTGGGTTTTAATGG + Intergenic
1002937159 6:1683422-1683444 CTGGATGGCTCTAGTTTTAAAGG + Intronic
1004560084 6:16741299-16741321 CTGGATAACTGTGGTTTTAAAGG + Intronic
1005102273 6:22185275-22185297 CTTGATATCTGTGCATTTAATGG + Intergenic
1007560624 6:42805458-42805480 TTGGAAAACTGAGGTTTTCAAGG + Intronic
1007837940 6:44690370-44690392 CTGAATCTCTGTGCTTTTAATGG + Intergenic
1011470020 6:87699739-87699761 CTGAATAAGTGTGCTTTAAAGGG + Intronic
1011529313 6:88302712-88302734 CCAGATAACTGTGTTTTAAAAGG - Intergenic
1012006759 6:93722165-93722187 CTGCATACTTGTGGTTTAAATGG - Intergenic
1013664139 6:112329250-112329272 CAGGATAGCTGTGATTTTCAGGG - Intergenic
1013711891 6:112910560-112910582 CTGCATTTCTGTTGTTTTAAGGG - Intergenic
1015913205 6:138188691-138188713 CAGGATAAATGTTGTGTTAAAGG - Intronic
1016789697 6:148055093-148055115 CAGGATAACAGTGATTTTCAGGG - Intergenic
1017854667 6:158339733-158339755 CAGGATAACAGTGATTTTCAGGG - Intronic
1018059885 6:160081857-160081879 CAGGATAACAGTGATTTTCAAGG - Intronic
1022995534 7:35751363-35751385 ATGGAGAACTCTGGTTTTAGGGG - Intergenic
1024126209 7:46298275-46298297 ATGGATAACTATGGTCCTAAAGG + Intergenic
1024567061 7:50689974-50689996 CTGGTTAATTGTGGTTAAAAAGG + Intronic
1025588664 7:62826598-62826620 CTGGAAAACTGTTTTTTGAAGGG + Intergenic
1026392287 7:69913572-69913594 AAGGATAGCAGTGGTTTTAAGGG - Intronic
1027339234 7:77188229-77188251 CAGGATAACTGGGGTGATAAAGG - Intronic
1027963179 7:84973110-84973132 CTCTGTAACTGAGGTTTTAAAGG - Intergenic
1028274707 7:88840365-88840387 CTGGATAAATATGTTTTAAATGG + Intronic
1028986542 7:97013451-97013473 CCGCATACCTGTGGTTCTAAAGG + Intergenic
1030623232 7:111815401-111815423 GTGGATACCTGTGGTGTTTAGGG + Intronic
1030655951 7:112168414-112168436 CTCGTTAACTGTGTTTTTAAAGG - Intronic
1030902530 7:115141995-115142017 CTGGGCAACTGTGGCTATAAAGG - Intergenic
1031073625 7:117190732-117190754 TTGGCTCACTGTGGTTTTATGGG + Intronic
1033191534 7:139285128-139285150 CGGGAAAACTGTGGTATAAAAGG - Intronic
1033677125 7:143553621-143553643 CAGGATAACAGTGATTTTCAGGG - Intergenic
1033694710 7:143775816-143775838 CAGGATAACAGTGATTTTCAGGG + Intergenic
1035701366 8:1641341-1641363 CTTGAAAACGGTGGTTTTGAAGG - Intronic
1037131976 8:15417509-15417531 CTGGACATCTGTGGTTTTACAGG - Intronic
1037530303 8:19766380-19766402 ATGGAAAACTGTGGTTTGAGTGG - Intergenic
1038365736 8:26931715-26931737 CAGGATAACTGTGTTTTTCCTGG + Intergenic
1038390287 8:27191972-27191994 CTGGAGAACTTTGATTTTAAGGG - Intergenic
1038547833 8:28439584-28439606 CTGGCTAATTGTGGTTTTTGGGG - Intronic
1038580708 8:28747030-28747052 CTTTATAACTGTTGTTTTCACGG - Intronic
1041514697 8:58688084-58688106 CTGGACAAGTGGGGTTTGAAGGG - Intergenic
1042699028 8:71591324-71591346 CTGAGTCACTGTGGTTTTCAGGG - Intronic
1043636724 8:82393114-82393136 CTTGATTACTGTGGCTTTATAGG + Intergenic
1045641018 8:104250845-104250867 GTGGATAACTGTGTCTTTCAGGG - Intronic
1045954392 8:107889802-107889824 CAGGATAACAGTGATTTTCAGGG - Intergenic
1046043997 8:108942307-108942329 CAGGATAACAGTGATTTTCAGGG + Intergenic
1046191357 8:110798942-110798964 CAGGATAACAGTGATTTTCAGGG - Intergenic
1046248949 8:111604584-111604606 CTGGATTTCTGTGTCTTTAAAGG + Intergenic
1050137696 9:2484810-2484832 CTGAATAATAGTGGTTATAATGG - Intergenic
1051587640 9:18743840-18743862 CTAGAATACAGTGGTTTTAAGGG + Intronic
1051699662 9:19808408-19808430 CTTGTTAACTGTTGTTCTAAGGG - Intergenic
1052061061 9:23962042-23962064 CAGGATAACAGTGATTTTCAGGG + Intergenic
1058703040 9:107616419-107616441 TTGGATATCTGTTCTTTTAAAGG - Intergenic
1059215646 9:112559319-112559341 CTGATAAACTTTGGTTTTAAAGG + Intronic
1059286369 9:113175215-113175237 CTGGATACGTATGTTTTTAAAGG - Intronic
1186532992 X:10316214-10316236 CTGGATCACTGGGTTTTTATTGG + Intergenic
1186693682 X:12006449-12006471 CTAAATAAATGTGGTATTAATGG + Intergenic
1186994587 X:15106191-15106213 CAGGATAACAGTGATTTTCAGGG - Intergenic
1187518887 X:19996238-19996260 CTGGACAACAGTGTTTTCAAGGG - Intergenic
1189459406 X:41226226-41226248 CTGGATAACCTTAGTTTTTACGG - Intronic
1193561989 X:83029898-83029920 CAGGATAACAGTGATTTTCAGGG - Intergenic
1194269261 X:91789999-91790021 TTGGATAACTGTAGTTTGAGGGG - Intronic
1196311179 X:114167666-114167688 CAGGATAACAGTGATTTTCAGGG - Intergenic
1196804559 X:119573238-119573260 CGAGATAACTGGGGTTTTGAAGG - Intergenic
1197899469 X:131354655-131354677 CTGGGAAACTTTGGTTTTGAGGG - Intronic
1198148092 X:133879076-133879098 CTGGATTACTGTGGCTTTGTTGG + Intronic
1198517317 X:137422787-137422809 CTGGATTAATGTGGAATTAAAGG - Intergenic
1199035278 X:143043100-143043122 CTGGATAAATGAGGCTTTACAGG - Intergenic
1199360815 X:146916075-146916097 CAGGATAACAGTGATTTTCAGGG - Intergenic
1200586479 Y:5010988-5011010 TTGGATAACTGTAGTTTGAGGGG - Intronic
1200842726 Y:7799764-7799786 CTGTACAACTGTGGTAATAAGGG + Intergenic
1201369930 Y:13252635-13252657 CTGGACGACTGTGGGTTTACAGG + Intronic
1201370597 Y:13258961-13258983 CTGGAAGACTGTGGATTTACGGG + Intronic