ID: 1004561804

View in Genome Browser
Species Human (GRCh38)
Location 6:16759968-16759990
Sequence TGCGCGCGCGCGCCGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004561804 Original CRISPR TGCGCGCGCGCGCCGGGCGG GGG (reversed) Intronic
900237476 1:1599701-1599723 GGCGCGCACGCGGCGCGCGGCGG + Exonic
900258871 1:1712297-1712319 GGAGCGCGAGCGGCGGGCGGAGG - Exonic
901242867 1:7704955-7704977 CGGGGGCGCGCGCGGGGCGGGGG + Intronic
901243007 1:7705511-7705533 GGCGCGCGCGGGCGGGGCTGGGG + Intronic
901361387 1:8703503-8703525 TGTGCGCGCGCCCGCGGCGGCGG - Intronic
901641347 1:10694615-10694637 CGGGCGGGCGCACCGGGCGGCGG - Intronic
901641371 1:10694698-10694720 GGCGCGGGCGCGCGCGGCGGGGG - Intronic
901641432 1:10694887-10694909 AGCGCGCGCGCGGCCGCCGGCGG - Intronic
901660148 1:10794198-10794220 TGCGCGCGCGCGCGCGTCGTGGG + Intronic
902348431 1:15835921-15835943 CGCGCGCGCTCGCCGTGCGGGGG + Intergenic
902585666 1:17437784-17437806 TGCGCCCGGGCGCCGCGGGGAGG - Intronic
902870673 1:19312042-19312064 AGCGCGCGGGCCTCGGGCGGCGG + Exonic
903389481 1:22953858-22953880 CGTGCGCGCGCGCCTGGCCGCGG - Exonic
903446081 1:23423926-23423948 TGCGGGGGCCCGCGGGGCGGGGG - Intronic
903514767 1:23902959-23902981 GGCGCGAGGGCGCGGGGCGGGGG - Intronic
904500155 1:30908597-30908619 CGGGCGCGGGCGGCGGGCGGCGG + Exonic
904822918 1:33256732-33256754 TGCGGGCGGGGGCCGGGCCGGGG + Intronic
905432084 1:37931743-37931765 GGAGCGCGCGGGACGGGCGGCGG - Intronic
905449375 1:38046912-38046934 CGGGCGGGCGCGCGGGGCGGGGG - Intergenic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
907351796 1:53838120-53838142 CGCGCGTGCGCGCTGGGCGGGGG - Intronic
908544088 1:65147779-65147801 CGCGCGCGGGCGGCGGGCAGCGG + Intronic
908999891 1:70205622-70205644 TGAGCGCGCGCTCTGGGCGCTGG + Intergenic
910549745 1:88462767-88462789 GGCGCGGGCGGGCCGGGCGGAGG - Intergenic
910760934 1:90730440-90730462 TGCGTGCGCGCGCCTGGGTGTGG - Intergenic
912716877 1:111989534-111989556 TCCTCGCGCGCGCGGGGCGCCGG - Intergenic
914171844 1:145232916-145232938 TGCCCGCCCGCCCCGCGCGGGGG + Intergenic
914803109 1:150974585-150974607 GGGGCTCGGGCGCCGGGCGGGGG + Intronic
914824757 1:151132763-151132785 GGAGAGCGCGGGCCGGGCGGGGG + Exonic
914869119 1:151458810-151458832 TGCGCGCGCGCGCGCCGCGGCGG + Intronic
914869154 1:151458903-151458925 TGTGCGTGCGCCCCGGGCCGCGG - Intronic
915143971 1:153783735-153783757 TGCAGGGGCCCGCCGGGCGGAGG - Intergenic
917433920 1:174999956-174999978 TGCGTGCTCGCGGTGGGCGGTGG + Exonic
918423490 1:184386741-184386763 TGTGCGCGCGCGCCCTGCAGCGG - Intergenic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
920600598 1:207320867-207320889 CGCGCGCGCGCGCCTCGGGGCGG - Intergenic
922958559 1:229625816-229625838 CGCGCGCGCGCGCGGGCGGGCGG - Intronic
923299714 1:232630046-232630068 TGCGCTCGGGCGGCCGGCGGGGG + Intergenic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
924289510 1:242523995-242524017 TGAGCGCGCGCGGGGCGCGGGGG - Intronic
924560664 1:245154795-245154817 TGCGCCCGGGCGCAGCGCGGAGG - Intergenic
1062843814 10:689789-689811 AGCGCGCGCGGGGCGGGCCGGGG - Intergenic
1063115538 10:3068977-3068999 TGAGCGCGCGGGGCGGGCGCGGG + Intronic
1066464400 10:35640333-35640355 GGCGCGGGCGCGGCGGGCGCGGG - Exonic
1068950127 10:62768482-62768504 TGCGTGCGTGCGCTGGGTGGGGG - Intergenic
1070150251 10:73800874-73800896 TGTGCGTGCGCGGGGGGCGGAGG + Intronic
1070328246 10:75401486-75401508 TGCGCGCTCGCCCCGGGAGCAGG + Exonic
1071573831 10:86711814-86711836 TTGGCCCGCGGGCCGGGCGGCGG + Intronic
1072710796 10:97714475-97714497 GGCGCACCCGCGCGGGGCGGCGG - Exonic
1073147955 10:101292622-101292644 TGCGTGTGCGCGGCGGGCGCGGG - Intergenic
1075037350 10:119080524-119080546 TCCCCGCGCGGGCCGGGCGGCGG + Intronic
1078594427 11:12674501-12674523 TGGGCGCCCGCGGCGGGCGGCGG - Intergenic
1079064369 11:17276713-17276735 CGGGCGCGCGCGGCGGGAGGAGG + Intronic
1081492484 11:43579210-43579232 TGCGAGCGCCGGCCGGGAGGGGG - Intronic
1081528276 11:43942075-43942097 TGCGCGCGCGCGCCTGCGGAGGG + Intronic
1081700049 11:45147011-45147033 TCGGCGCGGGCGCGGGGCGGGGG + Intronic
1081981434 11:47269623-47269645 TCCCCGCGCGCGCCCGGTGGAGG + Intronic
1083609736 11:63999182-63999204 TGCGCAAGGGCGCCTGGCGGTGG - Intronic
1083657043 11:64234722-64234744 GGCCCGGGCGCGGCGGGCGGGGG - Exonic
1083807532 11:65084010-65084032 TTGGCGCGCGCCCGGGGCGGCGG - Exonic
1083890295 11:65592507-65592529 TGCGCGCTCGCGGCGGGTGCGGG + Exonic
1084070081 11:66728186-66728208 GGCGGGGGCGCGGCGGGCGGGGG + Intronic
1084070122 11:66728320-66728342 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1084112552 11:67023389-67023411 TGCGTGCGCGCTGCGGGAGGCGG + Intronic
1084151230 11:67288954-67288976 CGCGCGTGCGCGGCGGGCCGCGG - Intronic
1084336606 11:68461202-68461224 ACCGGGCGCGGGCCGGGCGGGGG - Intronic
1084979607 11:72822160-72822182 TGCGCGCGCACGTCGGGCTCCGG + Exonic
1087027193 11:93661521-93661543 TGTGCGCGTGCGCGGGGCGCGGG + Intergenic
1088462237 11:110093517-110093539 CGCGCCCGGGCGCCAGGCGGAGG + Intronic
1088869024 11:113875647-113875669 TGCGCGCGCATGCCGGGGGCGGG - Intergenic
1088869026 11:113875651-113875673 TGCGTGCGCGCGCATGCCGGGGG - Intergenic
1089499807 11:118925467-118925489 TGGTCGCGGGCGCCGGGCAGTGG + Intronic
1089515857 11:119030898-119030920 TGCGCAAGCGCGGCCGGCGGGGG + Exonic
1093435327 12:19129676-19129698 CGCGGGGGCGCGCCGGGCCGGGG + Intergenic
1094218512 12:27970350-27970372 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1094565030 12:31591172-31591194 TGGGAGCGCGGGGCGGGCGGGGG + Intergenic
1095752965 12:45730318-45730340 CGCGTGCGCGCGGCGGGCGCGGG + Intronic
1096101295 12:48971829-48971851 CGCGCGCGCGCGCTGGGAGGAGG - Intergenic
1096139966 12:49234664-49234686 GGGGCGCGCTCGCCGGGCCGCGG - Intronic
1100613339 12:96210541-96210563 TGCGCCCGCGCGCAGGGCGGTGG - Intronic
1100679850 12:96907332-96907354 TGCGCGGACGCGGCGGGCGGGGG - Intronic
1102025709 12:109713547-109713569 TGCGCGCCGGCGCCGGGTGGAGG - Intergenic
1102084400 12:110124293-110124315 TGCGCGCGCGCGCGGGAGAGCGG + Intergenic
1102645426 12:114400622-114400644 TGAGCGAGCGCGCCCGGAGGCGG + Intronic
1102679964 12:114684637-114684659 CGCGCCCGGGCGCCGGGCAGGGG + Intergenic
1103308860 12:119989130-119989152 TGCCCGCGCGCGTCAGGCGCCGG + Intergenic
1103348347 12:120265739-120265761 GGCGCGGGCGCGCGCGGCGGCGG - Exonic
1103488198 12:121296743-121296765 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1103604797 12:122078732-122078754 TCCGCGAGCGCGCGGCGCGGCGG - Exonic
1103698542 12:122835643-122835665 GGCGAGCGGGCGGCGGGCGGCGG + Exonic
1103856296 12:123973052-123973074 GGAGCGCGCGCGCCGGGCGCTGG + Intronic
1103856370 12:123973249-123973271 CGCGCGCGCGCGCGGCTCGGAGG + Exonic
1104042241 12:125138204-125138226 TGCGGGCAGGCGCCGGGAGGAGG - Intronic
1104049522 12:125186358-125186380 AGCGAGCGAGCGCCGGGGGGAGG - Intergenic
1104980149 12:132570063-132570085 TTGGCGCGGGAGCCGGGCGGGGG - Exonic
1106087694 13:26557941-26557963 CGCGCGCTCCGGCCGGGCGGCGG + Intronic
1106109043 13:26760831-26760853 GCCGGGCGCGCGCGGGGCGGGGG - Intergenic
1107133529 13:36920367-36920389 TGCGCGGGCCCGGCGGGGGGCGG + Intronic
1110436295 13:75481469-75481491 TGCGTCCCCGCGCCGGGCGCTGG - Exonic
1110705973 13:78602256-78602278 GGCGCGGGCGCGGCGGCCGGCGG - Exonic
1113378592 13:109784651-109784673 GGCGGGTGCGGGCCGGGCGGCGG + Exonic
1113655608 13:112066664-112066686 TGAGCGCGCGCGCGCGGCGGCGG - Intergenic
1115545464 14:34462056-34462078 CGCGCGCGGGGGCCGGGCTGGGG - Intronic
1117377424 14:55129236-55129258 TGCGGGCGCCGGCGGGGCGGTGG - Exonic
1121617021 14:95320001-95320023 CGCGAGCGAGCGCGGGGCGGCGG + Intergenic
1122108725 14:99480684-99480706 TGCGCCCGCGCGGCCCGCGGGGG - Intronic
1122231111 14:100306638-100306660 TGGGCGCGCGGGCGGGGCGCGGG + Intergenic
1122736561 14:103847150-103847172 TGGGCGGGCGCGCCCGGCCGCGG - Intronic
1122779165 14:104136399-104136421 TGAACGCGCGGGCGGGGCGGCGG + Intergenic
1122884216 14:104703419-104703441 TGCGCGCGCGCACCCAGCTGCGG + Exonic
1122904656 14:104796084-104796106 TGCCTCCGCGCGCGGGGCGGGGG + Intergenic
1122975438 14:105168914-105168936 GGGGGGCGCGCGCCGGGCCGGGG - Intergenic
1123004452 14:105314678-105314700 GGCGCGCGCGGGGCGGCCGGGGG + Exonic
1124109530 15:26773153-26773175 CGCGCGCGGGCGCGGGGCGGGGG + Intronic
1124427056 15:29570980-29571002 GGAGCGCGCGGGGCGGGCGGGGG - Intergenic
1124922240 15:34038665-34038687 GGCGCGCGCCAGACGGGCGGCGG - Intronic
1125329091 15:38564819-38564841 TGAGCGCGCGCGCGAGGCAGAGG - Intronic
1126299996 15:47184595-47184617 TGCGCACGGGAACCGGGCGGCGG - Intronic
1126746403 15:51830005-51830027 TGCGCGAACGGCCCGGGCGGGGG + Intronic
1127867291 15:63042954-63042976 TGGGCGCGGGCGCAGGGCCGGGG - Intronic
1128547745 15:68579216-68579238 GGCGCGGGCGCGGCGTGCGGGGG - Exonic
1128791139 15:70434712-70434734 TGCGCGCGCGCGCGCGCGGGTGG - Intergenic
1129983557 15:79896738-79896760 AACGTGCGCGCGCCGGGGGGTGG + Intronic
1130335288 15:82952707-82952729 CGCCCGCCCGCGCCTGGCGGCGG - Exonic
1132055640 15:98648852-98648874 GGCGGGCGGGGGCCGGGCGGGGG + Intergenic
1132314293 15:100879405-100879427 CGGGCGAGCGCGCCGTGCGGCGG + Exonic
1132320160 15:100919522-100919544 TCCCCGCGGGCGCCGGGCGCGGG - Intronic
1132365281 15:101252156-101252178 GCCCCGCGGGCGCCGGGCGGGGG - Intergenic
1132885117 16:2179094-2179116 AGCGCGGGCGCGCCGGGGGACGG + Exonic
1133209210 16:4253810-4253832 AGCGCGCGGGCGCCAGGCGCGGG + Intergenic
1133209258 16:4253988-4254010 TGCTCAAGCGCGCCGGGCGATGG - Intergenic
1134134139 16:11668561-11668583 CGCGCGCTCGGGCCGGGCGGGGG + Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134441634 16:14302450-14302472 GGCAGGCGTGCGCCGGGCGGGGG - Intergenic
1138105298 16:54284613-54284635 TGCAGGCGGGGGCCGGGCGGTGG + Exonic
1138654205 16:58481467-58481489 TGCGCGCGCATGCAGGGTGGTGG + Intronic
1139637145 16:68264593-68264615 TGGGCGGGCGCGCCGGGAGCGGG + Intronic
1139917886 16:70439252-70439274 GGCGCGCGTGCGGGGGGCGGAGG - Intergenic
1141608525 16:85169105-85169127 GGCGGGCGCGCGGCGGGCGGGGG - Intergenic
1141608723 16:85169732-85169754 AGCTCGCGCGCGCCGGGCGCCGG - Intergenic
1141972340 16:87492449-87492471 GGCGGGCGCGCGCGGGGCGCCGG + Intergenic
1142049868 16:87951351-87951373 TGGGCGCGCGGGCCCGGGGGCGG - Intronic
1142156183 16:88533812-88533834 GGGGCGCGCGGGCCGGGCCGGGG - Exonic
1142156380 16:88534488-88534510 AGGCCGAGCGCGCCGGGCGGTGG - Exonic
1142293014 16:89201339-89201361 TGCGTGCGGGCGCGGGGCGCGGG + Intronic
1142429745 16:90019568-90019590 GGCGCGCGCGGGCCGGGGCGGGG - Intronic
1142704227 17:1684403-1684425 TGTGCGCGCGCGCAGGCGGGTGG - Intronic
1142810697 17:2394245-2394267 TGCGCGCGCGACCCGGGCCCCGG - Intronic
1143503543 17:7352066-7352088 GGCTCGCGCGGCCCGGGCGGAGG - Intronic
1144172832 17:12676225-12676247 TGCGTGCGCGCGCAGGGGGAGGG - Intronic
1144757151 17:17686608-17686630 TGCACGCGCGCGCCGGGGAGGGG + Intronic
1144759696 17:17700416-17700438 TGCGCGCGAACGCCGAGGGGCGG - Intronic
1144816596 17:18039596-18039618 GGCGCGCACGCGCGGGGTGGGGG - Exonic
1145243505 17:21253005-21253027 TGCAAGCGCGCGCCGCGGGGTGG - Intronic
1145938547 17:28728765-28728787 TCCGCGCACGCGCCGCGTGGGGG + Exonic
1146183315 17:30710240-30710262 TGCGTGTGCGCGCCGCGCGCCGG + Intergenic
1146398745 17:32487596-32487618 TGCTGCTGCGCGCCGGGCGGGGG - Exonic
1147440343 17:40443699-40443721 TGGGCGCGGGCGCGGGGCGCTGG - Exonic
1147987587 17:44315344-44315366 GGGGCGGGCGGGCCGGGCGGGGG + Intronic
1148000668 17:44385379-44385401 GGCGCGCGCGAGCCCGGAGGAGG + Intronic
1148013357 17:44503460-44503482 TGCGCGCGCCCGGTGGGCGTGGG - Intergenic
1148090264 17:45019101-45019123 GGCGCGGGCGGCCCGGGCGGGGG + Intergenic
1148225608 17:45896252-45896274 TCCGTGCGCGCTGCGGGCGGCGG + Intronic
1148284093 17:46372783-46372805 GGCGCGCGCGCGGCGGGGGCGGG + Intergenic
1148306314 17:46590704-46590726 GGCGCGCGCGCGGCGGGGGCGGG + Exonic
1149682230 17:58514549-58514571 GGCGCGCGGGAGCCGCGCGGAGG - Intronic
1150003766 17:61457166-61457188 TGCAGGCGCGCGCCTGGCCGAGG + Intronic
1150802045 17:68290642-68290664 TGCGTGCGCGCGCCAGCCTGGGG + Intronic
1150802318 17:68291761-68291783 CGCGCGCTCGCGCCTGGCCGAGG - Intronic
1150802434 17:68292216-68292238 TGCGCGCGCGCCCCGGGCCGGGG - Intronic
1151612118 17:75182986-75183008 TGCTCGCGCACGCAGGGTGGGGG - Intergenic
1151708400 17:75784999-75785021 CGTGCGCGCGCGGCGGGGGGGGG - Intronic
1152245606 17:79183214-79183236 GGCGCACGTGCGCCGGGCCGGGG + Intronic
1152349778 17:79778124-79778146 GGCGGGCCGGCGCCGGGCGGGGG + Exonic
1152628499 17:81399323-81399345 TGCGTGCGCGCGCGGGGCCCCGG + Intronic
1152689657 17:81712262-81712284 CGCGCGCGCGCCCCGGGGGCGGG - Intronic
1152714434 17:81891689-81891711 TGCGCGCGCGGGACGGGGTGAGG + Intronic
1153051987 18:908416-908438 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1153805272 18:8705198-8705220 TGGGCGAGGGCGCTGGGCGGCGG + Intergenic
1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG + Intronic
1153935211 18:9914556-9914578 TGCGCGCGCCGGCCGGGGCGAGG + Intronic
1155461547 18:26090191-26090213 GGGGCGCGTGCGCCCGGCGGCGG - Intronic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1156239728 18:35241148-35241170 TGGGAGCGCGCGCCGGACAGTGG + Intronic
1158427473 18:57352710-57352732 AGCGCGCGCGCGTGTGGCGGAGG - Exonic
1160631259 18:80247571-80247593 CGGGCGCGGGCGCCGGGAGGTGG - Intergenic
1160776904 19:860775-860797 TGAGTGCCCGCGCCGCGCGGGGG + Intronic
1160858796 19:1229039-1229061 TTCGCGCACGCGCCGGGCGACGG - Exonic
1160864101 19:1249594-1249616 TGCGGGCGCGGGCGGGGCGGGGG + Intronic
1160873202 19:1286226-1286248 TCGGCGCGCGCGAAGGGCGGCGG - Exonic
1160930771 19:1568486-1568508 CCCGCCCGAGCGCCGGGCGGAGG - Intergenic
1160947954 19:1652218-1652240 AGCGCGCGCGGGGCGGGCCGGGG + Intronic
1160999969 19:1905633-1905655 TGCGCGCGCGCGCGCGGCGCTGG + Intronic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161248967 19:3270493-3270515 TGCCCGCCCGAGCCGGGAGGAGG - Intronic
1161401597 19:4067971-4067993 TGCGACCGCGCGCCTGGGGGGGG + Intergenic
1161802572 19:6424358-6424380 CGCGCGCGCGCGCAGGGTCGCGG - Intronic
1161956936 19:7501351-7501373 TGCGGGCGCGCGTCGTGGGGTGG - Exonic
1162738088 19:12757735-12757757 TGCCCGCGCCCGCCGGCAGGAGG - Exonic
1162975474 19:14205520-14205542 TGCGTGTGCGCGCCGCGCGCCGG - Intronic
1163019252 19:14473846-14473868 CGCCCGCGCGCGCCTGGCGCTGG - Exonic
1163027088 19:14518608-14518630 TGTGCGCGCGCGCCGCGGGGAGG - Intronic
1163027094 19:14518617-14518639 GGCGCGCGCGCACAGGTCGGAGG + Intronic
1163138828 19:15332578-15332600 GGGGCGCGCACACCGGGCGGCGG - Intergenic
1163631323 19:18419366-18419388 GGGGCGCGCGCGGCGGGAGGAGG + Exonic
1164835077 19:31350755-31350777 TGCGGGCGACCCCCGGGCGGCGG + Intergenic
1165065377 19:33225516-33225538 GGCGGGCGGGCGCCGGGCGGAGG - Intronic
1165311399 19:35031006-35031028 TGCGCGCGGGAGCCGGGCTTGGG + Intronic
1165668593 19:37655494-37655516 TGCGCTAGCGCGCGGGGGGGCGG + Intronic
1165816791 19:38647565-38647587 GGCGCGCGCGCGCGGGAGGGCGG + Intergenic
1165838007 19:38771067-38771089 GGCGCGCGTGCGCCTGGTGGAGG - Exonic
1165841558 19:38791630-38791652 GGCGCGCGTGCGCCTGGTGGAGG + Exonic
1166084674 19:40467053-40467075 TGCGCGTGGGCCTCGGGCGGCGG + Intronic
1166094450 19:40530441-40530463 GGCGCGCGGCCGCCGCGCGGGGG + Intronic
1166121802 19:40691025-40691047 TGCCCGCCCCCGCCGGGCTGGGG - Intergenic
1166139726 19:40799464-40799486 GGGGAGCGCGCGCCGGGCGGAGG + Intronic
1166367384 19:42284430-42284452 CCCCCGCGCGCGCCGGGGGGCGG + Intronic
1167001207 19:46746519-46746541 ACCGCGCGCGCGCCCGGCGGGGG + Exonic
1167072956 19:47231157-47231179 TGCGAGCGGGCGCCTGGCGGCGG - Intronic
1168110542 19:54189410-54189432 CGCGGGGGCGCGCTGGGCGGGGG - Exonic
1168309370 19:55452771-55452793 GGCGTGCGCGCGCCGGCTGGGGG + Intergenic
1168408018 19:56120859-56120881 CGCGCGCGTGCGCGTGGCGGGGG - Intronic
925927677 2:8681911-8681933 TGGGCGCGGGCGCGGGGCGTGGG - Exonic
927168736 2:20350847-20350869 TGCGCGCGCCCGGTGGGCGGGGG - Intronic
928278301 2:29921622-29921644 CGCGAGCGCGCGCAGGGAGGGGG + Intergenic
928998758 2:37324904-37324926 GGCCCGCGCCCGCCGGGAGGTGG + Intergenic
929468620 2:42169314-42169336 TGCGCGCGGGCGCGGGGGCGGGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934993183 2:98935856-98935878 GGCGCGGGGGCACCGGGCGGAGG - Intronic
937203889 2:120223573-120223595 TGCTCGCGCGCGCGGGGTGCTGG - Intergenic
938451595 2:131425494-131425516 TCTGCGCGCCAGCCGGGCGGTGG - Intergenic
939613036 2:144332597-144332619 TGCGCGGGCGGGCCGAGGGGCGG - Intergenic
940883490 2:158969130-158969152 CGAGCGGGCGCGCCGGGCGGGGG - Intronic
942098653 2:172556604-172556626 TGCACACGTGCGCCGGGAGGCGG - Intronic
942890330 2:180980503-180980525 AGCTCGCGCCCGCCGGGCGTCGG + Intronic
944451803 2:199851122-199851144 TGCGCGCGGGCCACGCGCGGCGG - Intronic
944451810 2:199851152-199851174 TGCGCGCGGGCCACGCGCGGCGG - Intronic
945699393 2:213151668-213151690 TGCGCGAGCCCGGCCGGCGGGGG - Intronic
945699441 2:213151856-213151878 TGCGCGCGCGCGCGGGCTGGCGG + Intronic
946219959 2:218217546-218217568 TGAGCGCGCGCCCGGGGCCGGGG + Intronic
947741754 2:232487907-232487929 GGGGCGCGCGGGGCGGGCGGAGG - Intergenic
947860501 2:233354485-233354507 AGCGCGCGCACCGCGGGCGGGGG - Exonic
948645309 2:239400659-239400681 GGCCCGCGGGCGCCGGGCCGGGG + Exonic
948805926 2:240453438-240453460 TGCGGGAGCGGGGCGGGCGGAGG - Intronic
948910053 2:240998432-240998454 TGCGGGCGCGCGCCCTGTGGTGG - Intergenic
1169088167 20:2840170-2840192 TGCGCGCATGCGCGGGACGGCGG - Intronic
1170889974 20:20368433-20368455 TGGGCGCGCTCCGCGGGCGGCGG - Exonic
1172155358 20:32820174-32820196 AGCCCGCGCGCGCCGGGTGACGG - Intronic
1172284622 20:33732097-33732119 TGCGAGGGCGCGGCGGGAGGGGG - Intronic
1172688341 20:36773884-36773906 TACGCATGCGCGTCGGGCGGCGG - Intergenic
1173454056 20:43189657-43189679 TGAGCCCGGGCGCCGGGCAGTGG + Exonic
1173516172 20:43667027-43667049 GGCGCGCGGGCGCCGGGGGAGGG - Intronic
1173548125 20:43914733-43914755 AGCGCGCGCGGGCGGGGCGGGGG + Intergenic
1173576645 20:44116298-44116320 TGCGCCGGCGCCCCGGTCGGGGG + Exonic
1174002461 20:47384794-47384816 TGAGCCAGCGCGCCCGGCGGAGG + Intergenic
1174204346 20:48828032-48828054 AGCGCGCGGGGGCCGGGCGAGGG + Intergenic
1175429601 20:58891945-58891967 GGAGCGCGCGCCCGGGGCGGGGG - Intronic
1176015030 20:62926524-62926546 CGCCCCCGCGCGGCGGGCGGAGG + Intronic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176194587 20:63831336-63831358 GCCGGGCGCGCGCCGGGGGGCGG - Intergenic
1176380673 21:6110960-6110982 CGCGGCCGAGCGCCGGGCGGAGG - Intergenic
1176380798 21:6111326-6111348 TCCGCGCGGGCGCCGGGCCGGGG + Intronic
1177920333 21:27143877-27143899 CGCGCGCGCCCGCTGGCCGGCGG - Intergenic
1178488463 21:33033241-33033263 TGGGCGCGCGGCGCGGGCGGAGG + Intergenic
1179742674 21:43426914-43426936 TCCGCGCGGGCGCCGGGCCGGGG - Intronic
1179742799 21:43427280-43427302 CGCGGCCGAGCGCCGGGCGGAGG + Intergenic
1179968051 21:44818165-44818187 GGCGCGCGCAGGCCGGGCCGCGG + Intronic
1180064483 21:45405585-45405607 TGCGCGCGTGGGCAGGGCCGGGG - Intronic
1180649985 22:17369604-17369626 CGAGGGCGGGCGCCGGGCGGGGG - Exonic
1180748856 22:18110895-18110917 TGCGGGCGCGCGGCAGGCGTAGG + Intronic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1180908368 22:19431583-19431605 TGAGGGCGCGGGGCGGGCGGCGG - Exonic
1181026782 22:20131616-20131638 CGCGGGCGCCCGCCGGGCTGGGG + Intronic
1181574894 22:23787372-23787394 CGCGCGCGCGCTCGGGGCTGTGG + Intronic
1181831608 22:25564783-25564805 GGCGCGCGTGCGCGGGGCGCCGG + Intergenic
1181831639 22:25564893-25564915 GCGGCGCGCGCGCGGGGCGGGGG + Exonic
1182149511 22:28018294-28018316 TGTGTGCGCGCGCGGGGGGGGGG + Intronic
1182149513 22:28018298-28018320 TGCGCGCGCGGGGGGGGGGGCGG + Intronic
1182638756 22:31750196-31750218 AGTGCGCGCGCGCGGTGCGGGGG - Intergenic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1183650857 22:39152549-39152571 TGCGCGTGCGCGCCCGGACGAGG - Exonic
1184035461 22:41915746-41915768 TGCGGGTGGGCGCAGGGCGGAGG - Intergenic
1184101390 22:42343446-42343468 AGCGCGGGCGCGGCGGGGGGCGG - Intronic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
953748736 3:45594171-45594193 GGCGCGCGCGGGCCGGAGGGCGG - Intronic
954558758 3:51538667-51538689 CGGGCGCGCGGGCCGGGAGGGGG + Intergenic
954795900 3:53161275-53161297 GGCGCCCGCCCGCCGCGCGGAGG + Exonic
954823010 3:53347671-53347693 CGCGCGCACGCTCCGGGCGCCGG + Intergenic
956604955 3:71064871-71064893 CGCCCGCGCGGGCCGGGCGTGGG + Intronic
956605004 3:71065073-71065095 GGCGCGCGGGCGCGGGGCGCGGG - Intronic
957193339 3:77039022-77039044 TGCGCGATCGCGCAGGGCGAGGG - Intronic
958798620 3:98732486-98732508 CGCGCGCCCTCGCCGGGCGCCGG - Intronic
962575639 3:136752586-136752608 TGCGCGAGCGCTCCGTGTGGGGG - Intergenic
963827309 3:149970280-149970302 GGCGCGCGGGCCCCGGGTGGAGG - Intronic
965796837 3:172448716-172448738 TGCGTGTGGGCGCCGGCCGGAGG - Intergenic
966390943 3:179451607-179451629 AGCGCGCGCAGCCCGGGCGGGGG + Intergenic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
967858502 3:194135019-194135041 TGTGCGCGCGCCCCGGGGGCAGG - Intergenic
968479168 4:826228-826250 GGGCCGCGGGCGCCGGGCGGGGG + Intergenic
968701057 4:2058648-2058670 TGCGCGGCCGCGGGGGGCGGGGG + Intergenic
969330786 4:6472499-6472521 TGCGTCCGTGCGCCCGGCGGCGG + Intronic
969344743 4:6563681-6563703 TGAGCGCGGGCCCGGGGCGGGGG + Intergenic
977574085 4:98658729-98658751 TGCGCGCGCGCGCCTAGCCAAGG - Intergenic
977607221 4:98995548-98995570 TGCGCGCGCGGGGCGGGGGCGGG + Intergenic
977908256 4:102501556-102501578 GGCGCGCGGTGGCCGGGCGGCGG - Exonic
977908462 4:102502366-102502388 CGCGCGCGCGCGCACGGAGGGGG - Intronic
978777373 4:112516788-112516810 CCTGCGCGCGCGCCGGGCGGGGG - Intergenic
979205547 4:118033565-118033587 GGCGCGCGCGGGCCGGGAGCTGG + Intergenic
980053795 4:128061534-128061556 TGCGCGGCCTCGGCGGGCGGCGG + Intronic
981270778 4:142845919-142845941 AACGCGCGCGCGCCGGGCAGAGG + Intronic
984811413 4:183798422-183798444 GGAGTGCGCGGGCCGGGCGGAGG + Intergenic
985537424 5:473101-473123 TGCGCACGCGCGTTCGGCGGCGG - Intergenic
986402803 5:7396097-7396119 CGCGGGCGGGGGCCGGGCGGCGG - Intergenic
987050422 5:14143600-14143622 TGCGTCCGCGCGCCGGGCGCGGG + Intergenic
989056506 5:37371060-37371082 GGCGCGCGCGCCCTAGGCGGCGG - Exonic
992067402 5:73120507-73120529 TGCGCGGGCGCGGCGGCCCGGGG - Exonic
992088620 5:73299151-73299173 AGCGCCGGCGGGCCGGGCGGGGG - Intergenic
993501852 5:88674625-88674647 CGGGCGCGCGCGGCGGGTGGGGG - Intergenic
996184961 5:120464213-120464235 TGCGCGAGAGCGCCGGGCGGCGG + Intergenic
997585224 5:135039795-135039817 TCCCCGCGGGCGACGGGCGGCGG - Intronic
998131266 5:139652142-139652164 CGCGCGCGCGCGCGCGCCGGCGG - Intronic
998143251 5:139711414-139711436 TGCGCGCGCGCTCCGAGGGGAGG + Intergenic
999129449 5:149271800-149271822 CGCGGGCGCGGGCGGGGCGGGGG + Intergenic
999169484 5:149581433-149581455 TGCGTGCGTGCGCCGCGAGGGGG - Intronic
999399363 5:151252834-151252856 TGCGCGCGCGGGAGGGGCGGGGG - Intronic
1002139856 5:177132370-177132392 TGTGCGTGCGCGCCGGGCTGGGG - Intergenic
1002488761 5:179559103-179559125 CGCGCGCGCGCGCCCGGGTGAGG + Intronic
1002522116 5:179797848-179797870 TGCCCCCGCCCGCCGGGCCGCGG - Exonic
1002523991 5:179805870-179805892 TGGGCGCACGCGGAGGGCGGGGG + Intronic
1002559471 5:180071764-180071786 GGCGGGCGCGGCCCGGGCGGCGG + Exonic
1003942665 6:11044346-11044368 GGTGTGCGCGCGCCGGGCGTGGG - Intergenic
1004193625 6:13486203-13486225 TGCGCGCGCGCGCCTGGGAGAGG - Intronic
1004272885 6:14211083-14211105 TGCGTGCGCCCGCCGCGCGCGGG - Intergenic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1004720443 6:18264209-18264231 CGCGCGCGCACGCGGGGCAGCGG - Intronic
1004722167 6:18277310-18277332 TGAGGGCGCCCGCGGGGCGGAGG + Intergenic
1005039465 6:21588187-21588209 TGCGCGTGCACGGCGCGCGGGGG - Intergenic
1006396229 6:33789131-33789153 TGCGCGCCAGGGGCGGGCGGGGG - Exonic
1006787940 6:36680268-36680290 CGCGCGCGCGCGCCGGGAGCCGG - Intronic
1006814337 6:36840127-36840149 TGTGCGCGCGTGGCGGGCCGGGG + Intergenic
1006860911 6:37170900-37170922 GGGGAGGGCGCGCCGGGCGGGGG + Intronic
1007576654 6:42929510-42929532 TCCGCGCGCGCCGCGGGAGGAGG + Exonic
1007584196 6:42978854-42978876 TGCGGGCGCGGGCGGTGCGGCGG - Exonic
1011194040 6:84764184-84764206 GGCGGGCGGGCGCGGGGCGGGGG - Exonic
1011281132 6:85678924-85678946 TGCGGGCGCGCGCCGGGAAATGG - Intergenic
1011640472 6:89412335-89412357 CGCGCGCGCTCGCCCGGCCGCGG + Intergenic
1012245790 6:96924500-96924522 AGCGCGCTGGCGGCGGGCGGTGG + Intergenic
1012472919 6:99590893-99590915 AGGGCGCGAGCGCGGGGCGGTGG + Intergenic
1012872902 6:104693060-104693082 CGCGCGCGCGCGCTGGGGTGGGG + Intergenic
1013117573 6:107114782-107114804 GGAGCACGCGCGCCGCGCGGGGG - Intronic
1014632503 6:123803781-123803803 GGCGAGCGCGCGTCGGGCGGCGG + Intergenic
1014724924 6:124962477-124962499 TGCCCGCGGGCGCCGGGTGGGGG + Intergenic
1015910229 6:138162023-138162045 AGCGCGGGCGAGCCGGGCCGGGG - Exonic
1016820628 6:148343001-148343023 TGCGCGCGGGTGCGGGGCGAGGG + Exonic
1017282128 6:152636849-152636871 TGAGCGCGGGCGCCGGGCCGCGG - Intronic
1019308242 7:346597-346619 GGCGCGTGAGCCCCGGGCGGCGG - Intergenic
1019711356 7:2519579-2519601 TGCACGTGCGCGCCGGGGGCGGG + Intronic
1020192308 7:6009514-6009536 CGCGCGTGCGCACTGGGCGGGGG - Intronic
1020261090 7:6531192-6531214 CGCGCGCGCTCGCAGGGCAGAGG - Intronic
1021998337 7:26201635-26201657 GGCGCGCGCCCGGCGGGGGGAGG - Intronic
1021998339 7:26201639-26201661 AGCGGGCGCGCGCCCGGCGGGGG - Intronic
1023881859 7:44325323-44325345 GGCGCGCGCGGGCTGGGCCGGGG - Intronic
1023955725 7:44885371-44885393 GGCGCGAGCGCGGCGGGCGGTGG - Intergenic
1024089090 7:45920962-45920984 TCCGCGCACACGGCGGGCGGAGG + Exonic
1024394272 7:48848116-48848138 GGCGGGCGCGCGCGGGGCCGTGG - Intergenic
1024920232 7:54546580-54546602 TGCGGACGCGCGCCCGGAGGTGG - Intronic
1025032982 7:55572387-55572409 TGCCCGCCCGCCCCGCGCGGGGG - Exonic
1025259122 7:57405308-57405330 TGCACTGGCGGGCCGGGCGGCGG - Intergenic
1027774217 7:82444082-82444104 CGCCTGCGCACGCCGGGCGGCGG - Intergenic
1028417455 7:90595918-90595940 CCCGCGCGCGGGCGGGGCGGGGG + Intronic
1029496327 7:100896994-100897016 TGCGCGCGCGCGGCGGTGCGGGG + Intergenic
1029629806 7:101743304-101743326 TCCACGCGCGCGCCTGGCAGGGG + Intergenic
1029640442 7:101816485-101816507 TGCGCGCGCGAGCGGGGAGCGGG + Intronic
1032068631 7:128790978-128791000 TGGGGGCGCCGGCCGGGCGGGGG + Intronic
1032298766 7:130668321-130668343 TGCGCGCGGGCCTCCGGCGGGGG - Intronic
1033306732 7:140230801-140230823 GGGGCGCGCGGGCCGGGCCGTGG + Intergenic
1034618061 7:152436006-152436028 CGCGCGCAGGGGCCGGGCGGGGG + Intergenic
1034649214 7:152676167-152676189 TGCGCACGCGCGCGGGTGGGCGG - Intergenic
1037260441 8:17001874-17001896 GGAGCGCGCGCGGCGGGCCGGGG - Exonic
1038008821 8:23457657-23457679 TGCCGGCGGGGGCCGGGCGGGGG - Exonic
1038008834 8:23457691-23457713 AGCGGGCGCGCTCCGGGCGCAGG - Exonic
1038039749 8:23714675-23714697 TCCGCTCCCGCGGCGGGCGGCGG - Intergenic
1038767910 8:30446844-30446866 CGCGCGCGCGCGCGCGGTGGAGG + Intronic
1039996788 8:42541390-42541412 GGCGCGCGCAGCCCGGGCGGGGG + Intronic
1047423564 8:124727076-124727098 TGCGCGCGCGCGCGTGGGGGCGG - Intronic
1047961753 8:130016323-130016345 CGCGCGGGCCGGCCGGGCGGCGG + Intronic
1048484259 8:134832347-134832369 TGCGCGCGCGCGTGGGGAAGGGG + Intergenic
1049109616 8:140635151-140635173 AGCCCGCGGGCCCCGGGCGGGGG + Intronic
1049194634 8:141308502-141308524 TGCGCGCGGGGGCGGGGCAGGGG - Intergenic
1049212233 8:141392095-141392117 TCCGCGCCCGCTCGGGGCGGGGG + Intronic
1049237260 8:141518563-141518585 TGCGCCCGCGCGCGGGGCCCGGG + Exonic
1049616579 8:143578210-143578232 TTGGCGCGCGGGCCGGGCGCGGG - Exonic
1053001152 9:34577943-34577965 GGCGGGCGAGCGCGGGGCGGGGG + Intronic
1055611808 9:78031693-78031715 GGAGCGGGCGCGCCGGGCGCGGG - Intergenic
1055611831 9:78031764-78031786 TCTGCGCGCGAGCCGGGCGGTGG - Intergenic
1056154085 9:83817644-83817666 GGCAGGCTCGCGCCGGGCGGGGG + Exonic
1056356413 9:85805449-85805471 GGCAGGCTCGCGCCGGGCGGGGG - Intergenic
1056386309 9:86099682-86099704 GGTGCGCGCGCCCCGGCCGGTGG + Intronic
1056732537 9:89178331-89178353 GGCGCGCGCGACCCCGGCGGCGG - Exonic
1057619124 9:96619457-96619479 CGCGCGGGCGCTCGGGGCGGCGG + Exonic
1057758090 9:97853124-97853146 TGCGCCCGGGCCCCGGGGGGCGG + Intergenic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1058110737 9:101028865-101028887 TGCGCGCGCCCGTGGGGCGGAGG - Exonic
1058908257 9:109498361-109498383 CGGGCCCGCGCGCCGGGCGGGGG + Intergenic
1059191840 9:112333848-112333870 CGCGCGCGCGCGCCGGGCCGAGG - Intergenic
1059309221 9:113376984-113377006 GGTGCGCAAGCGCCGGGCGGTGG + Intronic
1059414670 9:114155577-114155599 TGAGGGCGCGCGGAGGGCGGTGG - Exonic
1060106783 9:120877442-120877464 CGCGCCCGCGGGGCGGGCGGGGG - Intronic
1060283372 9:122228489-122228511 CGCGCGCGCGAGCGGGGGGGGGG - Intronic
1060283491 9:122228884-122228906 TGCGCGCGGGCCGGGGGCGGGGG - Intronic
1060700513 9:125746658-125746680 TGCGGCCCCGCGCCGGGGGGAGG - Intergenic
1060973924 9:127754182-127754204 GGCGCGCGCAGGCCGGGAGGCGG - Intronic
1061128114 9:128689445-128689467 AGCGAGCGAGCGCCGGGAGGAGG + Intronic
1061472156 9:130835304-130835326 GGCGCGGGCGCGCGGGGCGGCGG + Intronic
1061580121 9:131531220-131531242 TGGGCGGGCGCGCCGGGCCTGGG - Intronic
1061680973 9:132242242-132242264 CGGGAGCGCGGGCCGGGCGGGGG - Exonic
1061975887 9:134067900-134067922 TGCGCGCGCGGGGCGGCGGGCGG - Intronic
1061975890 9:134067904-134067926 TCCTTGCGCGCGCGGGGCGGCGG - Intronic
1061976102 9:134068538-134068560 GGAGCGCGCGCGCGGGGCGGGGG + Intergenic
1061976104 9:134068542-134068564 CGCGCGCGCGGGGCGGGGGGCGG + Intergenic
1061987056 9:134136055-134136077 TGCGCGTGCGCGAGGGGAGGGGG - Intronic
1062100291 9:134724479-134724501 TGCGCACACGGGCGGGGCGGAGG - Intronic
1062542047 9:137045854-137045876 TGAGCGAGCGCGCTGGGCGCAGG - Intronic
1186496411 X:10015434-10015456 GGTGCACGGGCGCCGGGCGGAGG + Intergenic
1187507265 X:19887751-19887773 GACGCGCGGCCGCCGGGCGGGGG + Intergenic
1190714805 X:53094240-53094262 TGCGCGCGCGGCAGGGGCGGCGG + Intergenic
1193085858 X:77447621-77447643 GGCGCGCGCGGGCCGAGCCGGGG - Intergenic
1196440900 X:115719381-115719403 TGCTCGCGCACGCAGGGTGGAGG - Intergenic
1197655142 X:129108649-129108671 TGTGCGCGCGCGCGGCGGGGCGG + Intergenic
1197782487 X:130171887-130171909 TGCGCGCGCGCGCGTGAAGGGGG - Exonic
1198177799 X:134172871-134172893 CGCATGCGCGCGCCGGGTGGGGG - Intergenic
1199815964 X:151397146-151397168 TGCCCGTTCGCGCCGGGCGGCGG - Intronic
1200173598 X:154097136-154097158 TGCGCACGCGCGCCGGTGGGGGG + Intronic