ID: 1004564421

View in Genome Browser
Species Human (GRCh38)
Location 6:16782047-16782069
Sequence GGCTGCTTCCCCCTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004564419_1004564421 -10 Left 1004564419 6:16782034-16782056 CCCGCTGGGTCTTGGCTGCTTCC No data
Right 1004564421 6:16782047-16782069 GGCTGCTTCCCCCTTCCCACTGG No data
1004564415_1004564421 15 Left 1004564415 6:16782009-16782031 CCTTTGGGGATTGGCTAGCTTCT No data
Right 1004564421 6:16782047-16782069 GGCTGCTTCCCCCTTCCCACTGG No data
1004564411_1004564421 28 Left 1004564411 6:16781996-16782018 CCTCCCTGGCTGTCCTTTGGGGA No data
Right 1004564421 6:16782047-16782069 GGCTGCTTCCCCCTTCCCACTGG No data
1004564413_1004564421 24 Left 1004564413 6:16782000-16782022 CCTGGCTGTCCTTTGGGGATTGG No data
Right 1004564421 6:16782047-16782069 GGCTGCTTCCCCCTTCCCACTGG No data
1004564412_1004564421 25 Left 1004564412 6:16781999-16782021 CCCTGGCTGTCCTTTGGGGATTG No data
Right 1004564421 6:16782047-16782069 GGCTGCTTCCCCCTTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004564421 Original CRISPR GGCTGCTTCCCCCTTCCCAC TGG Intergenic
No off target data available for this crispr