ID: 1004566225

View in Genome Browser
Species Human (GRCh38)
Location 6:16800384-16800406
Sequence TTAACAACACACTACTCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004566225_1004566229 29 Left 1004566225 6:16800384-16800406 CCGTGTGAGTAGTGTGTTGTTAA No data
Right 1004566229 6:16800436-16800458 CTCAGCACAGAATCTAAAGAAGG No data
1004566225_1004566227 -5 Left 1004566225 6:16800384-16800406 CCGTGTGAGTAGTGTGTTGTTAA No data
Right 1004566227 6:16800402-16800424 GTTAATTTCATATTAATGCAGGG No data
1004566225_1004566226 -6 Left 1004566225 6:16800384-16800406 CCGTGTGAGTAGTGTGTTGTTAA No data
Right 1004566226 6:16800401-16800423 TGTTAATTTCATATTAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004566225 Original CRISPR TTAACAACACACTACTCACA CGG (reversed) Intergenic