ID: 1004566427

View in Genome Browser
Species Human (GRCh38)
Location 6:16802257-16802279
Sequence CTGGATGAAGAAAGGGACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004566420_1004566427 17 Left 1004566420 6:16802217-16802239 CCTCTATTTTTACATCTGTCAGC No data
Right 1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG No data
1004566423_1004566427 -5 Left 1004566423 6:16802239-16802261 CCAGAAAGCCACAAGGAGCTGGA No data
Right 1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004566427 Original CRISPR CTGGATGAAGAAAGGGACGA TGG Intergenic
No off target data available for this crispr