ID: 1004571615

View in Genome Browser
Species Human (GRCh38)
Location 6:16851265-16851287
Sequence CACTGTGTATGCATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004571612_1004571615 14 Left 1004571612 6:16851228-16851250 CCTCAAAAATATGATTTGCTATT No data
Right 1004571615 6:16851265-16851287 CACTGTGTATGCATGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004571615 Original CRISPR CACTGTGTATGCATGGAAGA GGG Intergenic
No off target data available for this crispr