ID: 1004573887

View in Genome Browser
Species Human (GRCh38)
Location 6:16873988-16874010
Sequence CAGGCCCCTTTGGAGTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004573880_1004573887 -2 Left 1004573880 6:16873967-16873989 CCAGGAGCTCCCACATATTCCCA No data
Right 1004573887 6:16873988-16874010 CAGGCCCCTTTGGAGTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004573887 Original CRISPR CAGGCCCCTTTGGAGTAGAT TGG Intergenic
No off target data available for this crispr