ID: 1004576067

View in Genome Browser
Species Human (GRCh38)
Location 6:16896382-16896404
Sequence TGCTGGTTATCTCTTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004576058_1004576067 22 Left 1004576058 6:16896337-16896359 CCAGATGTTGAGCTCCATGAATG No data
Right 1004576067 6:16896382-16896404 TGCTGGTTATCTCTTTCCCTGGG No data
1004576059_1004576067 8 Left 1004576059 6:16896351-16896373 CCATGAATGCCCAGCAGATTTCT No data
Right 1004576067 6:16896382-16896404 TGCTGGTTATCTCTTTCCCTGGG No data
1004576057_1004576067 23 Left 1004576057 6:16896336-16896358 CCCAGATGTTGAGCTCCATGAAT No data
Right 1004576067 6:16896382-16896404 TGCTGGTTATCTCTTTCCCTGGG No data
1004576063_1004576067 -2 Left 1004576063 6:16896361-16896383 CCAGCAGATTTCTAGGGCTCCTG No data
Right 1004576067 6:16896382-16896404 TGCTGGTTATCTCTTTCCCTGGG No data
1004576062_1004576067 -1 Left 1004576062 6:16896360-16896382 CCCAGCAGATTTCTAGGGCTCCT No data
Right 1004576067 6:16896382-16896404 TGCTGGTTATCTCTTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004576067 Original CRISPR TGCTGGTTATCTCTTTCCCT GGG Intergenic
No off target data available for this crispr