ID: 1004578357

View in Genome Browser
Species Human (GRCh38)
Location 6:16922434-16922456
Sequence ACCAGGACATTGACCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004578354_1004578357 2 Left 1004578354 6:16922409-16922431 CCTCTTCTATCTGCCAGCTCTGA No data
Right 1004578357 6:16922434-16922456 ACCAGGACATTGACCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004578357 Original CRISPR ACCAGGACATTGACCTCTGC TGG Intergenic
No off target data available for this crispr