ID: 1004581371

View in Genome Browser
Species Human (GRCh38)
Location 6:16956950-16956972
Sequence GAGATGTATCCCATCAATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004581371_1004581374 12 Left 1004581371 6:16956950-16956972 CCGGCATTGATGGGATACATCTC No data
Right 1004581374 6:16956985-16957007 CAGTTTCTTCATCTGTGAAACGG 0: 49
1: 625
2: 2982
3: 8106
4: 15003

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004581371 Original CRISPR GAGATGTATCCCATCAATGC CGG (reversed) Intergenic
No off target data available for this crispr