ID: 1004588124

View in Genome Browser
Species Human (GRCh38)
Location 6:17022453-17022475
Sequence AGAGCACAGAGGATGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004588124_1004588128 10 Left 1004588124 6:17022453-17022475 CCTCAAAACATCCTCTGTGCTCT No data
Right 1004588128 6:17022486-17022508 CCCTCCCTCTCCCAAACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004588124 Original CRISPR AGAGCACAGAGGATGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr