ID: 1004589576

View in Genome Browser
Species Human (GRCh38)
Location 6:17036322-17036344
Sequence ATTAAGAAACTCAATCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004589576_1004589581 28 Left 1004589576 6:17036322-17036344 CCCTCCTGATTGAGTTTCTTAAT No data
Right 1004589581 6:17036373-17036395 ACATGTGTCCCTCTTTGTCCAGG No data
1004589576_1004589579 -9 Left 1004589576 6:17036322-17036344 CCCTCCTGATTGAGTTTCTTAAT No data
Right 1004589579 6:17036336-17036358 TTTCTTAATGCATTCTTGTTTGG No data
1004589576_1004589580 2 Left 1004589576 6:17036322-17036344 CCCTCCTGATTGAGTTTCTTAAT No data
Right 1004589580 6:17036347-17036369 ATTCTTGTTTGGTAATGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004589576 Original CRISPR ATTAAGAAACTCAATCAGGA GGG (reversed) Intergenic
No off target data available for this crispr