ID: 1004590807

View in Genome Browser
Species Human (GRCh38)
Location 6:17050003-17050025
Sequence CATAGCTGTCACTTTAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004590807_1004590811 11 Left 1004590807 6:17050003-17050025 CCAAATTTAAAGTGACAGCTATG No data
Right 1004590811 6:17050037-17050059 ACTCAGGCAAGCCTGGCTTGAGG No data
1004590807_1004590809 -5 Left 1004590807 6:17050003-17050025 CCAAATTTAAAGTGACAGCTATG No data
Right 1004590809 6:17050021-17050043 CTATGTCAGGCTTCAAACTCAGG No data
1004590807_1004590812 12 Left 1004590807 6:17050003-17050025 CCAAATTTAAAGTGACAGCTATG No data
Right 1004590812 6:17050038-17050060 CTCAGGCAAGCCTGGCTTGAGGG No data
1004590807_1004590810 4 Left 1004590807 6:17050003-17050025 CCAAATTTAAAGTGACAGCTATG No data
Right 1004590810 6:17050030-17050052 GCTTCAAACTCAGGCAAGCCTGG No data
1004590807_1004590814 29 Left 1004590807 6:17050003-17050025 CCAAATTTAAAGTGACAGCTATG No data
Right 1004590814 6:17050055-17050077 TGAGGGCCTCTCCTTTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004590807 Original CRISPR CATAGCTGTCACTTTAAATT TGG (reversed) Intergenic
No off target data available for this crispr