ID: 1004591547

View in Genome Browser
Species Human (GRCh38)
Location 6:17056455-17056477
Sequence TGGAATAATCTTCATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004591547_1004591553 12 Left 1004591547 6:17056455-17056477 CCCACCCCATGAAGATTATTCCA No data
Right 1004591553 6:17056490-17056512 AGAGCAACACACTCAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004591547 Original CRISPR TGGAATAATCTTCATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr