ID: 1004593475

View in Genome Browser
Species Human (GRCh38)
Location 6:17076013-17076035
Sequence CAATATTAGATCAATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004593470_1004593475 16 Left 1004593470 6:17075974-17075996 CCCACGCAATAATAGTGGGAGAC 0: 9
1: 1265
2: 5124
3: 5091
4: 1827
Right 1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG No data
1004593471_1004593475 15 Left 1004593471 6:17075975-17075997 CCACGCAATAATAGTGGGAGACT 0: 10
1: 1339
2: 5289
3: 5395
4: 1884
Right 1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004593475 Original CRISPR CAATATTAGATCAATGAGAC AGG Intergenic
No off target data available for this crispr