ID: 1004593794

View in Genome Browser
Species Human (GRCh38)
Location 6:17079667-17079689
Sequence ACCGCATGTTCTCCCTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004593792_1004593794 19 Left 1004593792 6:17079625-17079647 CCATCATTCTCAGCAAACTAACA 0: 4182
1: 7493
2: 9826
3: 8930
4: 5489
Right 1004593794 6:17079667-17079689 ACCGCATGTTCTCCCTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004593794 Original CRISPR ACCGCATGTTCTCCCTCATA AGG Intergenic
No off target data available for this crispr