ID: 1004594619

View in Genome Browser
Species Human (GRCh38)
Location 6:17087218-17087240
Sequence CCTGATAGGCAGCATTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004594612_1004594619 27 Left 1004594612 6:17087168-17087190 CCAAGAACAACAGTTGGCGATCC No data
Right 1004594619 6:17087218-17087240 CCTGATAGGCAGCATTTCCATGG No data
1004594614_1004594619 5 Left 1004594614 6:17087190-17087212 CCCAGTTTTGAGAACACCTGTAG No data
Right 1004594619 6:17087218-17087240 CCTGATAGGCAGCATTTCCATGG No data
1004594613_1004594619 6 Left 1004594613 6:17087189-17087211 CCCCAGTTTTGAGAACACCTGTA No data
Right 1004594619 6:17087218-17087240 CCTGATAGGCAGCATTTCCATGG No data
1004594615_1004594619 4 Left 1004594615 6:17087191-17087213 CCAGTTTTGAGAACACCTGTAGT No data
Right 1004594619 6:17087218-17087240 CCTGATAGGCAGCATTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004594619 Original CRISPR CCTGATAGGCAGCATTTCCA TGG Intergenic
No off target data available for this crispr