ID: 1004599281

View in Genome Browser
Species Human (GRCh38)
Location 6:17132154-17132176
Sequence AAACCCTGCTGCACAAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004599281_1004599284 20 Left 1004599281 6:17132154-17132176 CCCATCTTTGTGCAGCAGGGTTT No data
Right 1004599284 6:17132197-17132219 AATGAGATTATGGAGTAGACTGG No data
1004599281_1004599283 10 Left 1004599281 6:17132154-17132176 CCCATCTTTGTGCAGCAGGGTTT No data
Right 1004599283 6:17132187-17132209 CAGCAAACAAAATGAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004599281 Original CRISPR AAACCCTGCTGCACAAAGAT GGG (reversed) Intergenic
No off target data available for this crispr