ID: 1004599283

View in Genome Browser
Species Human (GRCh38)
Location 6:17132187-17132209
Sequence CAGCAAACAAAATGAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004599281_1004599283 10 Left 1004599281 6:17132154-17132176 CCCATCTTTGTGCAGCAGGGTTT No data
Right 1004599283 6:17132187-17132209 CAGCAAACAAAATGAGATTATGG No data
1004599277_1004599283 30 Left 1004599277 6:17132134-17132156 CCTGCTTCCATTTCTAGCATCCC No data
Right 1004599283 6:17132187-17132209 CAGCAAACAAAATGAGATTATGG No data
1004599282_1004599283 9 Left 1004599282 6:17132155-17132177 CCATCTTTGTGCAGCAGGGTTTT No data
Right 1004599283 6:17132187-17132209 CAGCAAACAAAATGAGATTATGG No data
1004599278_1004599283 23 Left 1004599278 6:17132141-17132163 CCATTTCTAGCATCCCATCTTTG No data
Right 1004599283 6:17132187-17132209 CAGCAAACAAAATGAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004599283 Original CRISPR CAGCAAACAAAATGAGATTA TGG Intergenic