ID: 1004599284

View in Genome Browser
Species Human (GRCh38)
Location 6:17132197-17132219
Sequence AATGAGATTATGGAGTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004599282_1004599284 19 Left 1004599282 6:17132155-17132177 CCATCTTTGTGCAGCAGGGTTTT No data
Right 1004599284 6:17132197-17132219 AATGAGATTATGGAGTAGACTGG No data
1004599281_1004599284 20 Left 1004599281 6:17132154-17132176 CCCATCTTTGTGCAGCAGGGTTT No data
Right 1004599284 6:17132197-17132219 AATGAGATTATGGAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004599284 Original CRISPR AATGAGATTATGGAGTAGAC TGG Intergenic