ID: 1004603193

View in Genome Browser
Species Human (GRCh38)
Location 6:17170418-17170440
Sequence TCCCTGTGCTGAGGGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004603184_1004603193 15 Left 1004603184 6:17170380-17170402 CCTTACTTCTAGTAGCTAACCTG No data
Right 1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG No data
1004603190_1004603193 -4 Left 1004603190 6:17170399-17170421 CCTGGGTGTGGGGTGTCTCTCCC No data
Right 1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004603193 Original CRISPR TCCCTGTGCTGAGGGAGTGA AGG Intergenic
No off target data available for this crispr