ID: 1004604536

View in Genome Browser
Species Human (GRCh38)
Location 6:17181703-17181725
Sequence GTCTGGAAGGGGGTCATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004604536_1004604548 7 Left 1004604536 6:17181703-17181725 CCACTCATGACCCCCTTCCAGAC No data
Right 1004604548 6:17181733-17181755 CCTACCAAGGGCCATTTCACTGG No data
1004604536_1004604553 15 Left 1004604536 6:17181703-17181725 CCACTCATGACCCCCTTCCAGAC No data
Right 1004604553 6:17181741-17181763 GGGCCATTTCACTGGGGGTTAGG No data
1004604536_1004604549 8 Left 1004604536 6:17181703-17181725 CCACTCATGACCCCCTTCCAGAC No data
Right 1004604549 6:17181734-17181756 CTACCAAGGGCCATTTCACTGGG No data
1004604536_1004604543 -5 Left 1004604536 6:17181703-17181725 CCACTCATGACCCCCTTCCAGAC No data
Right 1004604543 6:17181721-17181743 CAGACCAAATCCCCTACCAAGGG No data
1004604536_1004604550 9 Left 1004604536 6:17181703-17181725 CCACTCATGACCCCCTTCCAGAC No data
Right 1004604550 6:17181735-17181757 TACCAAGGGCCATTTCACTGGGG No data
1004604536_1004604551 10 Left 1004604536 6:17181703-17181725 CCACTCATGACCCCCTTCCAGAC No data
Right 1004604551 6:17181736-17181758 ACCAAGGGCCATTTCACTGGGGG No data
1004604536_1004604542 -6 Left 1004604536 6:17181703-17181725 CCACTCATGACCCCCTTCCAGAC No data
Right 1004604542 6:17181720-17181742 CCAGACCAAATCCCCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004604536 Original CRISPR GTCTGGAAGGGGGTCATGAG TGG (reversed) Intergenic
No off target data available for this crispr