ID: 1004609125

View in Genome Browser
Species Human (GRCh38)
Location 6:17222431-17222453
Sequence ACCAGGGTGGAGGGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004609125_1004609135 10 Left 1004609125 6:17222431-17222453 CCTGCTTCCCCCTCCACCCTGGT No data
Right 1004609135 6:17222464-17222486 CTGAGGCCTCCCCACCCATGTGG 0: 18
1: 1936
2: 5904
3: 6863
4: 5591
1004609125_1004609132 -7 Left 1004609125 6:17222431-17222453 CCTGCTTCCCCCTCCACCCTGGT No data
Right 1004609132 6:17222447-17222469 CCCTGGTTGTAAGTTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004609125 Original CRISPR ACCAGGGTGGAGGGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr