ID: 1004610329

View in Genome Browser
Species Human (GRCh38)
Location 6:17233544-17233566
Sequence CTCAAAGCCCAGAGTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004610329_1004610331 0 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610331 6:17233567-17233589 CAATGTAATACAGGTACAAGTGG No data
1004610329_1004610334 3 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610334 6:17233570-17233592 TGTAATACAGGTACAAGTGGGGG No data
1004610329_1004610333 2 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610333 6:17233569-17233591 ATGTAATACAGGTACAAGTGGGG No data
1004610329_1004610337 27 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610337 6:17233594-17233616 GTGCAAAGGGCCTGTGCATTAGG No data
1004610329_1004610332 1 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610332 6:17233568-17233590 AATGTAATACAGGTACAAGTGGG No data
1004610329_1004610335 13 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610335 6:17233580-17233602 GTACAAGTGGGGGTGTGCAAAGG No data
1004610329_1004610338 28 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610338 6:17233595-17233617 TGCAAAGGGCCTGTGCATTAGGG No data
1004610329_1004610330 -9 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610330 6:17233558-17233580 GGCTTTGAGCAATGTAATACAGG No data
1004610329_1004610336 14 Left 1004610329 6:17233544-17233566 CCATTCTGACTCTGGGCTTTGAG No data
Right 1004610336 6:17233581-17233603 TACAAGTGGGGGTGTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004610329 Original CRISPR CTCAAAGCCCAGAGTCAGAA TGG (reversed) Intergenic
No off target data available for this crispr