ID: 1004614782

View in Genome Browser
Species Human (GRCh38)
Location 6:17280428-17280450
Sequence TGGCCCCAAAAAGCCAGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004614782_1004614792 19 Left 1004614782 6:17280428-17280450 CCCGCACTGGCTTTTTGGGGCCA No data
Right 1004614792 6:17280470-17280492 TTCTCACTCTTCAGACCCCAGGG No data
1004614782_1004614791 18 Left 1004614782 6:17280428-17280450 CCCGCACTGGCTTTTTGGGGCCA No data
Right 1004614791 6:17280469-17280491 CTTCTCACTCTTCAGACCCCAGG No data
1004614782_1004614786 -10 Left 1004614782 6:17280428-17280450 CCCGCACTGGCTTTTTGGGGCCA No data
Right 1004614786 6:17280441-17280463 TTTGGGGCCAAAGAAAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004614782 Original CRISPR TGGCCCCAAAAAGCCAGTGC GGG (reversed) Intergenic