ID: 1004615402

View in Genome Browser
Species Human (GRCh38)
Location 6:17283124-17283146
Sequence GTGTGCAAAAATGGATCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004615397_1004615402 1 Left 1004615397 6:17283100-17283122 CCTCTCAAGGCTTGAAATGTACC 0: 1
1: 0
2: 2
3: 5
4: 93
Right 1004615402 6:17283124-17283146 GTGTGCAAAAATGGATCTTGGGG 0: 1
1: 1
2: 1
3: 9
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004615402 Original CRISPR GTGTGCAAAAATGGATCTTG GGG Intronic
902454860 1:16525776-16525798 TTGTGCAAGAATGGATATTAAGG - Intergenic
902497305 1:16882122-16882144 TTGTGCAAGAATGGATATTAAGG + Intronic
905784688 1:40744967-40744989 GTGTGTAAAAGTGGATCTTGAGG - Intronic
913505470 1:119512831-119512853 GTGTTCAAAAATTAATCTTGTGG - Intronic
913657857 1:120978549-120978571 TTGTGCAAGAATGGATATTAAGG - Intergenic
914009207 1:143761623-143761645 TTGTGCAAGAATGGATATTAAGG - Intergenic
914522428 1:148429807-148429829 TTGTGCAAGAATGGATATTAAGG - Intergenic
914647837 1:149670273-149670295 TTGTGCAAGAATGGATATTAAGG - Intergenic
916473010 1:165142046-165142068 GAGTTCAAAAATTCATCTTGTGG - Intergenic
917773393 1:178305645-178305667 GTGTGCAAAAATTGAGCTGCTGG - Intronic
920500730 1:206483387-206483409 GAGTGCACAAATGGATTTTAAGG - Intronic
922859796 1:228806658-228806680 GTGGGCATGAATGGATGTTGGGG - Intergenic
923126092 1:231035816-231035838 GTTTGCAAAAATGGAGCAAGGGG - Intronic
1069254072 10:66310404-66310426 GGGTACAGAAATGGATCGTGGGG - Intronic
1069580398 10:69562132-69562154 CTGAGCAAAAAAGGATATTGGGG + Intergenic
1072243195 10:93516981-93517003 AAGTGCAAAAAAAGATCTTGAGG + Exonic
1075283580 10:121162739-121162761 TTGTGCCAAAATGGATGGTGGGG - Intergenic
1075478963 10:122762969-122762991 GTCTGCAAGAATGGACCTTCGGG + Intergenic
1076717788 10:132375180-132375202 GTGTTAAAAAATGTATTTTGAGG - Exonic
1079064528 11:17277412-17277434 GTGAGCAAATATGGTTATTGTGG + Intronic
1079274346 11:19020365-19020387 GTGTGCAAAAAGAAATTTTGAGG - Intergenic
1081659098 11:44877067-44877089 GTGTGCACAAATGCAGCCTGTGG + Intronic
1086205527 11:84253820-84253842 GTGGGGAAAAATGAATTTTGAGG - Intronic
1089026808 11:115279256-115279278 GGTTGCAAAAATGGATTTGGGGG + Intronic
1090315020 11:125778630-125778652 GTTTTCAAAATTGGCTCTTGGGG - Intronic
1090898397 11:131001975-131001997 GTGTCAAAAAATGGTTATTGGGG + Intergenic
1096055148 12:48644398-48644420 GTGTTAAAAAATGGATCCTTTGG - Intergenic
1096371745 12:51074627-51074649 ATGTCTAAAAATGGATTTTGTGG - Intronic
1096597029 12:52702431-52702453 GTGTGTATAAATGGATTGTGTGG + Intronic
1096597048 12:52702562-52702584 GTGTGTATAAATGGATTGTGTGG + Intronic
1099717086 12:86309634-86309656 GTGTCCAAACATGAATTTTGGGG + Intronic
1102310040 12:111837529-111837551 CTGTGCAAACATGAATTTTGGGG - Intergenic
1103027398 12:117584516-117584538 GTGTGTTAAAATGGATTCTGAGG + Intronic
1108162444 13:47655968-47655990 GAGTGAGAAAATGGATCTTTGGG - Intergenic
1109119528 13:58436671-58436693 GTGTACAAAAATGTATAATGTGG + Intergenic
1109203849 13:59460079-59460101 TTGCACAAAAATGTATCTTGTGG + Intergenic
1111311886 13:86500337-86500359 GTGTATGAAAATGTATCTTGGGG + Intergenic
1112231373 13:97591971-97591993 GTGTAAATAATTGGATCTTGAGG - Intergenic
1113295718 13:108956588-108956610 GTGTGCAAAATTGGAGCCTACGG - Intronic
1115418693 14:33167276-33167298 GTATGCAAAAATTTATTTTGAGG + Intronic
1117327398 14:54682164-54682186 GTGTGCACAGAAGAATCTTGAGG + Intronic
1118104764 14:62645661-62645683 GTGTGTAAAAATGAATATTATGG - Intergenic
1121601513 14:95208168-95208190 GTGAGCAAAAACGTAACTTGGGG - Intronic
1122482654 14:102057206-102057228 GTGTGCAACTATGCAGCTTGTGG - Intergenic
1124571472 15:30868063-30868085 GTGTGCCTAAATCCATCTTGTGG + Intergenic
1128371347 15:67041702-67041724 ATTTGCAAGAATGGCTCTTGGGG + Intergenic
1128836941 15:70816591-70816613 ATGTGCAAAAATTGATCATCTGG + Intergenic
1129162951 15:73757264-73757286 GGGTGCAAAACTGGATGTTATGG + Intergenic
1129646296 15:77436756-77436778 ATGTGTAAGAATGGATCTAGAGG - Intronic
1129946838 15:79545795-79545817 GTGTGCCACAATGGAACTAGGGG - Intergenic
1133345800 16:5069750-5069772 GGGGGCAAAAATGGCTCTTGGGG - Intronic
1137232923 16:46585070-46585092 ATGTGCAAAAAAAGATTTTGGGG + Intronic
1138080211 16:54083640-54083662 GTGTGTAAAAATGGGACTCGAGG - Intronic
1138972156 16:62158769-62158791 GTGTGCAAAAAGGGATCTTGTGG + Intergenic
1140112790 16:72018072-72018094 GTCTTCAAAAATGCATGTTGTGG - Intronic
1144422880 17:15114125-15114147 GTGTGCAAGGCTGGTTCTTGTGG + Intergenic
1145390766 17:22454017-22454039 GCCTGCAAAATGGGATCTTGTGG - Intergenic
1145838790 17:27976251-27976273 GAGAGCAAAAATGGGTCCTGAGG - Intergenic
1149468581 17:56898524-56898546 GAGGGCAAAAATGGATCCTTGGG + Intronic
1150194684 17:63284838-63284860 AGCTGCAAAAATGGATTTTGTGG + Intronic
1150795942 17:68236878-68236900 GTGTGTAAAAAAGGATGTTTGGG - Intergenic
1151979926 17:77502739-77502761 GTGTGCAAGGATGGAAATTGGGG - Intergenic
1153219497 18:2848721-2848743 GTGTGAATAAATGGCTGTTGAGG + Intronic
1154061714 18:11067772-11067794 ATTTGTAAAAATGGATATTGAGG - Intronic
1156107750 18:33686227-33686249 ATACGCAAGAATGGATCTTGTGG + Intronic
1157150170 18:45208972-45208994 ATGATCAAAAATGGATTTTGAGG + Intergenic
1160170641 18:76550281-76550303 GTTTGCAAAATGGGGTCTTGAGG + Intergenic
1161031276 19:2058784-2058806 GTGTGCAACAAGGGATCCTATGG + Intergenic
1165337436 19:35181356-35181378 ATGTGCAGAAATGGATCTTAAGG + Intergenic
1167730494 19:51250774-51250796 TTGTGCCCAATTGGATCTTGAGG - Intronic
926076479 2:9947171-9947193 GTGTGCAAAAATGTAGTTAGAGG + Intergenic
930619599 2:53630140-53630162 GTGTGCAGGAAGGGAGCTTGTGG - Intronic
938014221 2:127854112-127854134 GTGCACAAAAATAGATTTTGGGG - Intronic
939306756 2:140421593-140421615 GTATGCAAAAATGGGTGTTTGGG + Intronic
940302638 2:152191593-152191615 GTGTTCATAAAGGGATCTGGAGG + Intergenic
940850096 2:158679774-158679796 GTGAGCAAATATGGTTCTAGAGG - Intronic
941398453 2:165000711-165000733 GTGTGCTAAAATATATTTTGAGG + Intergenic
946014520 2:216593278-216593300 GTGTGTAATAATGGTTCTTCAGG - Intergenic
946726384 2:222665565-222665587 ATGGGAAAAAATGAATCTTGGGG - Intergenic
948364925 2:237448623-237448645 GGGTGCAAACATGGATCTCTCGG + Intergenic
1170678791 20:18506851-18506873 GTGTGTAAAAATGGTTGTGGTGG + Intergenic
1170857419 20:20070011-20070033 TTATGCACAAATGGTTCTTGGGG + Intronic
1170885815 20:20339060-20339082 CTGTGCAAAAATGATTTTTGTGG + Intronic
1172044278 20:32068964-32068986 TTGTGCAAAAATGGAACTCATGG + Intronic
1173163207 20:40667679-40667701 GTGTACAAAAATGTGTGTTGGGG + Intergenic
1174433523 20:50488852-50488874 AAGTCCAAAAATGGGTCTTGTGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1179886285 21:44315544-44315566 GTGGGCAAACATGGGGCTTGTGG + Intronic
1181765154 22:25086313-25086335 GAGTGAAAAAGTGGTTCTTGTGG + Intronic
1181878775 22:25960684-25960706 GTGAGCAAAAATGGGTCAGGAGG - Intronic
1182755112 22:32673024-32673046 GTGGGAAAAAATGGATCTCAGGG + Intronic
1183021627 22:35031757-35031779 CTGTGCAAAAATGGGCCTTTTGG - Intergenic
949373114 3:3356490-3356512 GTGAACAAAAATGGAATTTGTGG + Intergenic
949542305 3:5042426-5042448 TTGTTCAAAAATGTATCCTGAGG - Intergenic
950410181 3:12831115-12831137 GAGTGCAAACATGTAGCTTGGGG - Intronic
952012248 3:28913043-28913065 ATGTTGAAAAATGGATTTTGAGG + Intergenic
952858010 3:37788659-37788681 GTGTGCTAAAATGGATGAAGCGG + Intronic
955952782 3:64258923-64258945 GGGTGCAAAAAGGGATTGTGGGG + Intronic
958091385 3:88881106-88881128 GTGTGTTCAAATGGATATTGGGG - Intergenic
963261611 3:143197525-143197547 GGGAGCAAAAATGTATCTGGGGG - Intergenic
963686785 3:148445326-148445348 GTGTGCATAAGTGGAGGTTGTGG - Intergenic
964624497 3:158746325-158746347 ATTTGCACAAATAGATCTTGTGG - Intronic
964855066 3:161137952-161137974 GTGTGCAAAAATTGAGATGGAGG + Intronic
964947395 3:162243052-162243074 GTGTGTACACATGGATCTTGGGG - Intergenic
965926933 3:173992620-173992642 TTGTCCAAAAATAGATGTTGTGG + Intronic
967930384 3:194686575-194686597 GTGTGCAAAAAAGGTTGGTGCGG - Exonic
970324426 4:14908700-14908722 GTATGAGAAAATGGATCTGGAGG - Intergenic
971013030 4:22460033-22460055 GTGTGCAAGAATGTATCTCTTGG - Intronic
971672328 4:29578623-29578645 GTGTGCCAAAATGGATTTACAGG + Intergenic
972932535 4:44091102-44091124 GTGTGCACCCATGGAGCTTGAGG + Intergenic
974134414 4:57796698-57796720 GAGAGCAAAAATAGTTCTTGGGG + Intergenic
974920377 4:68231766-68231788 GAATGCATAAATGTATCTTGTGG + Intronic
977459402 4:97306573-97306595 GTGTACAAAAGTGTTTCTTGTGG + Intronic
979628611 4:122875405-122875427 GTGTGCAAATATCTATCTAGTGG - Intronic
980395764 4:132213164-132213186 ACATGTAAAAATGGATCTTGAGG + Intergenic
980920437 4:139080830-139080852 GTGTGCCAAATTGGAACTTGAGG - Intronic
981648654 4:147029578-147029600 GTGAATAAAAATGGAACTTGTGG + Intergenic
982492479 4:156046353-156046375 ATGTGCAGAAATGCATCCTGAGG + Intergenic
985226135 4:187763775-187763797 GTGTGGGAAAATGGATATTAAGG - Intergenic
986911898 5:12567630-12567652 GTGGGCTCAAATGGATCATGTGG - Intergenic
987890129 5:23865223-23865245 GTTTTAAAAAAAGGATCTTGTGG + Intergenic
988641106 5:33041535-33041557 GTGTGTAGGAATGGATCTTATGG + Intergenic
990058711 5:51619279-51619301 GAGTGCAAGAAGGGAACTTGGGG + Intergenic
993969139 5:94395773-94395795 GTGTGCAAACAGGTATCTAGTGG - Intronic
995080060 5:108040480-108040502 GTGTGCAGAAATAGAATTTGTGG - Intronic
996275112 5:121656320-121656342 CTGTGTAAAGATGGATTTTGTGG - Intergenic
996406859 5:123114044-123114066 GTGTGCAAAAAGTGCTTTTGAGG + Intronic
997635290 5:135399726-135399748 GTGCGCAGTAATTGATCTTGGGG - Intronic
1002706298 5:181162650-181162672 GAGTGCTAAGATGGATTTTGAGG - Intergenic
1004615402 6:17283124-17283146 GTGTGCAAAAATGGATCTTGGGG + Intronic
1006422058 6:33941049-33941071 ATGTGTAGAAATGGATTTTGAGG + Intergenic
1008642273 6:53476166-53476188 GAGTTCAAAAATGAATTTTGAGG + Intergenic
1009722070 6:67485218-67485240 GTGTACAAAAATGGAGATGGCGG - Intergenic
1011044143 6:83063675-83063697 GTGTGTAAAATAGTATCTTGTGG - Intronic
1012604482 6:101141088-101141110 GTGATCAAAAATGCATGTTGGGG + Intergenic
1012625244 6:101396873-101396895 ATGTGCAAAATTGGTTCTTTGGG + Intergenic
1013444623 6:110211234-110211256 GTGTGAAAAGATGGAGCTTAAGG + Intronic
1021427422 7:20517879-20517901 GTGTGTAAATTAGGATCTTGTGG - Intergenic
1023282040 7:38580781-38580803 TTGGGCATAAATGGATTTTGTGG - Intronic
1024389672 7:48793872-48793894 GAGAGCAAAAATGCAGCTTGTGG + Intergenic
1028130525 7:87166993-87167015 GAGGGCAAATATGGTTCTTGGGG - Intronic
1028774390 7:94660846-94660868 GGCTGCAACAATGGAACTTGGGG - Intronic
1031869931 7:127080466-127080488 GTGACCAAAATTGGTTCTTGGGG - Intronic
1032128712 7:129212317-129212339 CTGGGCAGAAATGGATCCTGAGG - Exonic
1033058407 7:138081358-138081380 GTGTGTGAGAGTGGATCTTGGGG - Intronic
1035084463 7:156246623-156246645 GTGAGAAAAATTGCATCTTGTGG - Intergenic
1038361433 8:26883340-26883362 GGTTGCTAAACTGGATCTTGTGG + Intergenic
1040722892 8:50347978-50348000 GTATGTAAAAATGTTTCTTGGGG - Intronic
1047770506 8:128026786-128026808 GTGTGCAAAGAAAGACCTTGTGG + Intergenic
1047883348 8:129220399-129220421 GTGGACAAAAATTGATCTTGAGG + Intergenic
1048866921 8:138768160-138768182 ATGTCCAGAAATGGATTTTGGGG - Intronic
1053179963 9:35960388-35960410 GTGTGCATAGATTTATCTTGTGG - Intergenic
1054830872 9:69623174-69623196 GTTTTGAAACATGGATCTTGGGG + Intronic
1056003945 9:82247395-82247417 GTGAGAAAAACTGCATCTTGTGG - Intergenic
1056225297 9:84489333-84489355 GTGAGCAATAATGGATCATGTGG + Intergenic
1056974308 9:91236646-91236668 GTGTGCATAACTGGAGGTTGTGG + Intronic
1059461498 9:114433445-114433467 CTGTGTTAAAATGGATCTTGCGG + Intronic
1059941091 9:119360713-119360735 GTGAGAAATAATGGAGCTTGGGG - Intronic
1185825179 X:3242851-3242873 GTCTGCAAGAATGGTTCTTCTGG - Intergenic
1185831199 X:3304607-3304629 AAGTGCAGAAAAGGATCTTGTGG + Intergenic
1188826741 X:34844576-34844598 GTGAGCAAAAATGAATATGGAGG + Intergenic
1190146180 X:47893464-47893486 GGGTTCAAAAATGGATATTTTGG + Intronic
1190247143 X:48698027-48698049 GTGTGAAAAAATATACCTTGTGG + Intronic
1191123849 X:56933321-56933343 GTGGGAAAAACTGCATCTTGTGG + Intergenic
1192494722 X:71608051-71608073 GCCTGCAAAAATGAATCTGGAGG + Intronic
1193175225 X:78384543-78384565 GTGGGAAAGAATGAATCTTGTGG + Intergenic
1193491881 X:82160637-82160659 TTGTGCAAAAATGGATGAAGAGG - Intergenic
1194330290 X:92575459-92575481 ATGTGCAAAAATAGACTTTGTGG + Intronic
1195226766 X:102803462-102803484 GAATGCAACAATGGATTTTGGGG - Intergenic
1195767436 X:108311288-108311310 GTGTGCTGAAATGGAGTTTGAGG - Intronic
1199191875 X:144980583-144980605 GTGAGAAAAACTGTATCTTGTGG + Intergenic
1199983927 X:152936944-152936966 ATGGGCAAAAATGGCTCCTGGGG + Intronic
1200639000 Y:5694632-5694654 ATGTGCAAAAATAGACTTTGTGG + Intronic
1201313403 Y:12618960-12618982 GTAAGCAAAACTGGATCTTGTGG - Intergenic