ID: 1004615739

View in Genome Browser
Species Human (GRCh38)
Location 6:17287170-17287192
Sequence ATGACCAGGTGTGATTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004615739_1004615743 21 Left 1004615739 6:17287170-17287192 CCTAACAAATCACACCTGGTCAT 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1004615743 6:17287214-17287236 ACATGTTCCTATTTTAGGCCTGG 0: 1
1: 0
2: 0
3: 19
4: 184
1004615739_1004615742 16 Left 1004615739 6:17287170-17287192 CCTAACAAATCACACCTGGTCAT 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1004615742 6:17287209-17287231 ATGCTACATGTTCCTATTTTAGG 0: 1
1: 0
2: 0
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004615739 Original CRISPR ATGACCAGGTGTGATTTGTT AGG (reversed) Intronic
903353749 1:22733873-22733895 TTGACCTGGTATGATTTGGTGGG + Intronic
903353761 1:22733930-22733952 TTGGCCTGGTGTGATTTGGTGGG + Intronic
904881624 1:33701983-33702005 CTGATCAGGTCTGATTTTTTGGG - Intronic
904907017 1:33905206-33905228 AAGCCCATGTGTGATTTGTTGGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910061977 1:83104714-83104736 ATGACCATGTGTCATAGGTTGGG - Intergenic
911035670 1:93543518-93543540 ATGACCAGGTATGTTTTGAATGG + Intronic
911283102 1:95955875-95955897 ATGACCATGTCTCCTTTGTTCGG + Intergenic
911310008 1:96280485-96280507 GTGGCCAGGTGTCATTTTTTTGG + Intergenic
913493622 1:119405828-119405850 ATGAGCTGGTATGATTTTTTGGG - Intergenic
913972944 1:143429926-143429948 ATGAACTGGTGTGATTATTTGGG + Intergenic
914067328 1:144255533-144255555 ATGAACTGGTGTGATTATTTGGG + Intergenic
914111825 1:144710821-144710843 ATGAACTGGTGTGATTATTTGGG - Intergenic
916642386 1:166744449-166744471 GTGACCAGGTGGGATTGGCTTGG + Intergenic
917793334 1:178513835-178513857 ACGACAAGATGTGATTTGTTAGG + Intronic
918462520 1:184791006-184791028 CTGACCAGATGTCATTTATTTGG - Intronic
919595907 1:199562411-199562433 ATGACTAGCTGTGATATTTTTGG - Intergenic
920630092 1:207644406-207644428 ATGAGCAGGATTGATTTGTAGGG - Intergenic
920905351 1:210159363-210159385 ATGACCAGATGTCAATCGTTGGG - Intronic
921422338 1:214963102-214963124 ATGAGCACTTGTCATTTGTTTGG + Intergenic
923329977 1:232914224-232914246 ATGACCCCGTGTCCTTTGTTCGG - Intergenic
924625006 1:245690147-245690169 ATGAGCAGGGGTAATTTCTTTGG - Intronic
924781905 1:247157842-247157864 ATGACCTGGTGTGAGGTGCTTGG + Intronic
924796259 1:247294631-247294653 ATGGCCAGGTGTGCAGTGTTGGG - Intergenic
1062760913 10:17887-17909 ATGAACTGGTGTGATTTTTTGGG - Intergenic
1063538443 10:6908538-6908560 ATGACAAGGTGTCATATTTTGGG - Intergenic
1066533179 10:36362676-36362698 ATGAACAGGTGTAATTTTCTTGG + Intergenic
1066747197 10:38612376-38612398 ATGAACTGGTGTGATTCTTTGGG - Intergenic
1067145930 10:43693971-43693993 AGGACCAGGTGGGATTTGCTGGG - Intergenic
1069488742 10:68843412-68843434 ATAACCAGGTGTGAATTGGAGGG + Intronic
1073708496 10:106014159-106014181 ATGCCCAGGGGTGATGTGTATGG + Intergenic
1074693532 10:116028193-116028215 AGCACCAGGTGGGATTTGTCAGG + Intergenic
1075779674 10:125009105-125009127 ATGACCCTGTGTCCTTTGTTGGG + Intronic
1080245389 11:30174280-30174302 ATGAGCATGTCTGTTTTGTTTGG - Intergenic
1080836628 11:35945560-35945582 AGGAGCAGGTGTGAATTGTTTGG + Intronic
1081354609 11:42096790-42096812 ATGTACAGGTGTGATGTGCTTGG + Intergenic
1088758834 11:112910274-112910296 ATGAACAGGTCAAATTTGTTAGG + Intergenic
1090527306 11:127551320-127551342 ATGACTAGGTTTTATTTGTTGGG + Intergenic
1091511212 12:1128313-1128335 ATGATCAGATATGACTTGTTAGG + Intronic
1093610712 12:21151855-21151877 ATGACTAGGTGTAACTTTTTGGG + Intronic
1095260688 12:40095412-40095434 ATGTCCAGCTGTAATTTTTTAGG + Intronic
1099280939 12:80645235-80645257 ATTAACAGGTGTACTTTGTTAGG - Intronic
1102153487 12:110705232-110705254 ATGACTCGATGTCATTTGTTAGG + Intergenic
1103713245 12:122928689-122928711 AAGAACAGGTGGCATTTGTTGGG + Intronic
1105577091 13:21663616-21663638 ATGCCCGGGTGTAATTTTTTTGG + Intergenic
1110579045 13:77097480-77097502 AGGCCCAGGGGTAATTTGTTTGG - Exonic
1110925772 13:81149602-81149624 ATGATGAGGTGTGATCTGATTGG + Intergenic
1111588231 13:90309805-90309827 ATTACAAGGTGGGTTTTGTTAGG + Intergenic
1114030686 14:18577423-18577445 ATGAACTGGTGTGATTTTTGGGG + Intergenic
1114162268 14:20181208-20181230 ATGACCATGTGTAACTTGTAAGG - Intergenic
1115172435 14:30524634-30524656 ATGCCAAGGTGTCATATGTTGGG + Intergenic
1115509563 14:34126387-34126409 ATGAGCAGGGGTGATATGTGTGG - Intronic
1115969912 14:38933233-38933255 ATGAGCTAGTGTGATTTTTTGGG - Intergenic
1116053860 14:39839212-39839234 ATGACCAGGTGTGATCGGGGTGG + Intergenic
1117221663 14:53612363-53612385 ATGACCAAGTGTGGTCTGGTGGG - Intergenic
1118710238 14:68512980-68513002 AGGAACAAGTGTGATGTGTTTGG + Intronic
1120370170 14:83623433-83623455 ATGAACAGATGTGCTTGGTTTGG + Intergenic
1122395988 14:101431742-101431764 ATGACCACGTGTGGTTTGTCAGG - Intergenic
1122689751 14:103526548-103526570 GTAACCAGGTGTGATTTCTGAGG - Intergenic
1122696928 14:103559591-103559613 ATGATGTGGTGTGGTTTGTTTGG - Intronic
1125917989 15:43506664-43506686 ATGACCAAGTATGATCTTTTGGG - Intronic
1128447097 15:67773317-67773339 ATGACCATTTGGGAATTGTTAGG - Intronic
1132235455 15:100216756-100216778 ATGAGCAGGGGTGAATTGTTAGG - Intronic
1133676071 16:8073366-8073388 ATGGCCAGGTGTGGTGTCTTAGG - Intergenic
1133912902 16:10082051-10082073 GTGTCCAGGTGGGATTTGCTTGG - Intronic
1136735870 16:32467269-32467291 ATGAACTGGTGTGATTCTTTGGG + Intergenic
1139578586 16:67858041-67858063 ATGACTAGGGGTGCTTTGTCAGG + Intronic
1139730156 16:68936903-68936925 AAGAGCTTGTGTGATTTGTTTGG - Intronic
1140166159 16:72554122-72554144 ATGACCAAGTGGGGTTTATTAGG + Intergenic
1140410284 16:74737099-74737121 AAGAACAGGTGTGATTTGAGGGG - Intronic
1141549217 16:84794042-84794064 ATGACCAAGTGGGGTTTATTTGG - Intergenic
1203017205 16_KI270728v1_random:362305-362327 ATGAACTGGTGTGATTCTTTGGG - Intergenic
1203035540 16_KI270728v1_random:635463-635485 ATGAACTGGTGTGATTCTTTGGG - Intergenic
1149019040 17:51942292-51942314 GTGACCAGTTGTGTTGTGTTTGG - Intronic
1152953820 18:18241-18263 ATGAACTGGTGTGATTTTTTGGG - Intergenic
1152985370 18:316016-316038 ACCTCCAGGTGTGGTTTGTTGGG + Intergenic
1153129831 18:1842026-1842048 ATCACCAGGTATGATTTATCTGG + Intergenic
1153969934 18:10216897-10216919 CTGCCCAGCTGTGATTTGCTTGG - Intergenic
1156355539 18:36337321-36337343 GTGACCAGGTCTGGTGTGTTTGG - Intronic
1156454383 18:37284862-37284884 GTGACTGGGTGTGATTTCTTGGG - Intronic
1158004200 18:52653342-52653364 ATGACCAGGTGATATGTGATAGG + Intronic
1158082234 18:53606140-53606162 ATGACAAGCTGGGATTTGATGGG - Intergenic
1158519396 18:58158669-58158691 TTGACCACGTGTTATGTGTTGGG + Intronic
1163263526 19:16205251-16205273 ATGCCCAGGTGTGAAATGTGGGG - Intronic
1164044813 19:21527792-21527814 AGATGCAGGTGTGATTTGTTTGG + Intronic
1166556126 19:43700853-43700875 ATGGCCTGGAGTGATTTCTTAGG - Intergenic
1166772219 19:45290749-45290771 ATGACCGGCTGTGTTTGGTTTGG + Intronic
1167307083 19:48715451-48715473 AAGAGCAGGTGTGATGTTTTAGG + Intronic
1168178826 19:54645484-54645506 ATGCCCAGGTGTTTTTTGTACGG - Intronic
926094514 2:10072615-10072637 AAGCCCAGGTTTGGTTTGTTTGG + Intronic
927679645 2:25131368-25131390 ATGACCAGGTGTGAGTGCTGCGG - Exonic
928440561 2:31288525-31288547 AGGAGCAGGGGTGATTTGTTTGG - Intergenic
932564017 2:72894425-72894447 ATGACCAGCTGGGATTAGTCTGG + Intergenic
934177641 2:89590882-89590904 ATGAACTGGTGTGATTATTTGGG + Intergenic
934287940 2:91665183-91665205 ATGAACTGGTGTGATTATTTGGG + Intergenic
934309598 2:91851545-91851567 ATGAACTGGTGTGATTCTTTGGG - Intergenic
935044763 2:99470801-99470823 ATGACCCGGTCTCCTTTGTTCGG + Intronic
935362041 2:102253599-102253621 ATGACCAGGTGTGAATTCACAGG + Intergenic
937753874 2:125512907-125512929 AAGACCAGGTGTAATATTTTAGG + Intergenic
937884318 2:126889653-126889675 AGGACCAGGTGTGCTTTGCAGGG - Intergenic
938497523 2:131808342-131808364 ATGAACTGGTGTGATTTTTGGGG - Intergenic
939251223 2:139684020-139684042 ATGACCAGATCTCATTTCTTTGG + Intergenic
944320029 2:198329888-198329910 AAGACCAATTGAGATTTGTTTGG - Intronic
946772681 2:223104988-223105010 ATGAGCAGATGTGATGTGTGTGG + Intronic
947251195 2:228106299-228106321 ATATCCAGTTGTGATTGGTTTGG - Intronic
1170245651 20:14219565-14219587 ATGAACTAGTGTGATTTTTTGGG + Intronic
1172991878 20:39042713-39042735 ATGACCAGGTGGAATTTGCGTGG + Intergenic
1175386965 20:58603422-58603444 ATGACCATGTGTGACTTCTGAGG - Intergenic
1177149893 21:17444921-17444943 ATGTCCATGTGTGATTAGCTAGG + Intronic
1177174333 21:17688571-17688593 GTGAACAAGTGTGATTTTTTGGG + Intergenic
1178666204 21:34549168-34549190 ATGAGCATGTGTGCTTTGTTTGG + Intronic
1179331918 21:40411932-40411954 AGGACCTGGTGGGAGTTGTTTGG + Intronic
1180454800 22:15504479-15504501 ATGAACTGGTGTGATTTTTGGGG + Intergenic
1180536693 22:16398684-16398706 ATGAACTGGTGTGATTCTTTGGG - Intergenic
1181296436 22:21843658-21843680 AAGAACAGGTGAGATTTATTAGG + Intronic
1181454436 22:23048442-23048464 ATGAGCTAGTGTGATTTTTTGGG - Intergenic
1183926999 22:41213437-41213459 AAGGCCAGGTGTGATTTGGCGGG - Intronic
1184107845 22:42378879-42378901 AAGATCAGGTGAGACTTGTTTGG + Intergenic
950603451 3:14057177-14057199 GTGAGCAGGTATGATTTTTTGGG + Intronic
951304344 3:21039959-21039981 ATTATCAGGATTGATTTGTTAGG - Intergenic
951967226 3:28399882-28399904 ATGAGCTAGTGTGATTTTTTGGG - Intronic
955762483 3:62302445-62302467 ATGCCTAAGTGTGATTTTTTTGG - Intergenic
956920986 3:73929134-73929156 ATGAACAGGTGTGTTGTGCTAGG + Intergenic
959037019 3:101378729-101378751 ATGCCTAGGTGTTATTTTTTGGG - Intronic
959918692 3:111847479-111847501 ATGGCCAGGTGTGATGGGATGGG - Intronic
961905386 3:130257540-130257562 ATGTCCAGTTGTGGTTTGTTGGG - Intergenic
962423016 3:135244548-135244570 ATGACCAGGTTTGAATTGTATGG - Intronic
964075770 3:152689381-152689403 ATGAGCTAGTGTGATTTTTTGGG - Intergenic
964662781 3:159139407-159139429 ATGACCAGGAGTGAGAAGTTGGG - Intronic
964992708 3:162833889-162833911 ATGACCAAGTGGGATTTATTTGG + Intergenic
971410795 4:26369674-26369696 CTGACCAGATTTGGTTTGTTAGG + Intronic
972630169 4:40835703-40835725 GTGACCCCATGTGATTTGTTTGG + Intronic
973108336 4:46368657-46368679 ATACTCAAGTGTGATTTGTTTGG + Intronic
973149276 4:46866970-46866992 AAAACCAGGTGAGATTTGATAGG - Intronic
973330900 4:48909405-48909427 ATGACCAATTGGTATTTGTTGGG + Intergenic
975226765 4:71881520-71881542 TTGGCCAGATGTGAATTGTTGGG + Intergenic
977171343 4:93766495-93766517 ATTACAAGGTGAGATTTGTGTGG + Intronic
977932725 4:102766087-102766109 ATGCCCAGGTGTAGTTTTTTGGG - Intergenic
980237957 4:130132575-130132597 ATGAGCTAGTGTGATTTTTTGGG - Intergenic
984441444 4:179775549-179775571 TAGACCATGTGTGATATGTTTGG - Intergenic
984692093 4:182738371-182738393 AAGATGAGCTGTGATTTGTTTGG + Intronic
986317401 5:6599750-6599772 ATGACCAGGACTGCTTTCTTTGG - Exonic
989303324 5:39920571-39920593 ATTACCAGTTGTGAATTGTACGG + Intergenic
989398878 5:40987687-40987709 GTGAACTGGTGTGATTTTTTGGG + Intergenic
989562678 5:42870219-42870241 ATGAGCTGGTGTGATCTTTTGGG + Intronic
990758021 5:59097487-59097509 ATGCCTTGGTGTGATTTGCTTGG - Intronic
1001290803 5:170457797-170457819 GTGACCTAGTGTGATTTTTTGGG - Intronic
1002367623 5:178725496-178725518 AAAACCAAGTCTGATTTGTTTGG - Intronic
1003641636 6:7880143-7880165 AAGACCAGGTGTCATTTCTAAGG + Intronic
1004615739 6:17287170-17287192 ATGACCAGGTGTGATTTGTTAGG - Intronic
1006387282 6:33738327-33738349 AGGCCCAGGTGTGATTTGGCTGG - Intronic
1012225182 6:96695017-96695039 ATGAGCTAGTGTGATTTTTTTGG - Intergenic
1012734725 6:102924764-102924786 ATGACCACGTTTTATTTGTAAGG + Intergenic
1013645504 6:112135350-112135372 GTTACCAGGTGTAATTTTTTTGG + Intronic
1013863891 6:114670687-114670709 ATGACCAGGTGGGATATGCAAGG - Intergenic
1021390127 7:20082684-20082706 ATTACCAGGTTGGATTTGGTAGG - Intergenic
1021400171 7:20200984-20201006 ATGACTAGGTGTTATTTGGTGGG + Intronic
1022643900 7:32213153-32213175 AGCCCCAGGTGTGTTTTGTTTGG + Intronic
1023917889 7:44604068-44604090 ACAACAAGGTGTGATCTGTTTGG - Intergenic
1024745261 7:52399325-52399347 GTGAACTAGTGTGATTTGTTGGG + Intergenic
1027616422 7:80430168-80430190 ATGACCATGTGGGTTTTGGTGGG + Intronic
1031966875 7:128032889-128032911 ATGACCAAGTGTGATGAGCTGGG + Intronic
1034238270 7:149589640-149589662 TTAATCAGGTGTGTTTTGTTTGG - Intergenic
1034608641 7:152343613-152343635 GTGACCAGGTGTAGTTTGTTTGG - Intronic
1037268038 8:17089732-17089754 ATGACCACATGTGATTGGTATGG + Intronic
1039947758 8:42144581-42144603 AGGGCCAGGTGTCATGTGTTTGG + Intergenic
1045558686 8:103239761-103239783 ATGTAAAGATGTGATTTGTTAGG + Intergenic
1046291685 8:112170361-112170383 ATGATGAGGTGTGATCTGATTGG - Intergenic
1046840692 8:118853524-118853546 ATCACCAGGACTTATTTGTTAGG + Intergenic
1047301588 8:123618143-123618165 GTGAGCAGGTGTGAAATGTTTGG + Intergenic
1047922420 8:129649094-129649116 ATGTCCACGTTTCATTTGTTGGG + Intergenic
1048523441 8:135178853-135178875 ATTGGCAGGTGTGATTTGTGGGG - Intergenic
1051289440 9:15530250-15530272 ATTATCAGGTGTGATTTGAGGGG + Intergenic
1051733234 9:20169784-20169806 TTGACCTAGTGTGATTTTTTGGG - Intergenic
1055799154 9:80013727-80013749 ATGCCCAGGTGTGATTTTCTTGG + Intergenic
1056158958 9:83869099-83869121 ATCACCAGTTGTAATTTTTTAGG - Intronic
1056351610 9:85754814-85754836 ATCACCAGTTGTAATTTTTTAGG + Intergenic
1057418398 9:94886267-94886289 GGGACCAGGTGTGCTGTGTTGGG + Intronic
1058365895 9:104207865-104207887 ATGCCCAGGTGTGGTTTTTTGGG - Intergenic
1059976392 9:119722485-119722507 ATTTCCAGGAGTGAGTTGTTAGG + Intergenic
1061513132 9:131072858-131072880 ATGCCCAGGTTTGGTGTGTTCGG - Intronic
1061632635 9:131882808-131882830 ATCACCTGGAGTCATTTGTTAGG + Intronic
1188058053 X:25564433-25564455 ATGACCAAGTGTGAGTTCTGAGG + Intergenic
1191603639 X:63038593-63038615 ATGATCAAGTGTGTTTTTTTTGG - Intergenic
1193690489 X:84635309-84635331 ATGACCTAGTGTGATGTTTTGGG - Intergenic
1194524010 X:94954599-94954621 ATGAACTGATGTGATTTCTTTGG + Intergenic
1196396321 X:115265918-115265940 ATGAAGAGGTTTGATTTATTAGG - Intergenic
1197651097 X:129064893-129064915 TTCTCCAGGTGAGATTTGTTGGG + Intergenic
1198195999 X:134363174-134363196 ATTACCTGGTGTGATTTGTATGG - Intergenic
1199599236 X:149531933-149531955 AGGGCCAGGTGGGATTTGGTAGG - Intronic
1199711820 X:150474900-150474922 ATGACCAGGGCTGAGTTCTTAGG - Intronic
1201702114 Y:16895149-16895171 ATTACCAGGTGTGATGGGATTGG - Intergenic