ID: 1004616116

View in Genome Browser
Species Human (GRCh38)
Location 6:17291019-17291041
Sequence CTGTCACAAGAGGCTGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004616116 Original CRISPR CTGTCACAAGAGGCTGTCGT GGG (reversed) Intronic
905332519 1:37215887-37215909 TTGTTACCAGAGGCTGTCGGAGG + Intergenic
906867344 1:49436742-49436764 CTGTCTAAATAAGCTGTCGTCGG - Intronic
912949058 1:114107918-114107940 CTGTCAGGAGAGGCTGCCTTAGG + Intronic
918171196 1:181999026-181999048 CTGTTACAATTGGCTGTCCTGGG + Intergenic
920163606 1:204018991-204019013 CTGCCTCAAGAGGCTGAGGTTGG + Intergenic
921106173 1:211981157-211981179 CTGGAACAAGATGCTGTCTTTGG - Exonic
924373771 1:243384994-243385016 CTGTCATAAGACGCTGTGCTAGG + Intronic
1063296381 10:4811011-4811033 CTGGGACAAGAGGCTGCCGAAGG - Intronic
1064056992 10:12106261-12106283 CTGTCAGAAGAGGCCGTCCTGGG + Exonic
1067877414 10:50018532-50018554 TTGTCCCCAGAGGCTGTGGTGGG + Intergenic
1070132634 10:73665800-73665822 TTGTCCCCAGAGGCTGTGGTGGG - Intergenic
1070305285 10:75235670-75235692 CTGCCACAGGCGGCTGTCCTCGG + Exonic
1074383950 10:113002462-113002484 CTGTCACAGGGGGCTGTCCTGGG - Intronic
1076350897 10:129814548-129814570 TTGCCAGAAGAGGCTGTCTTAGG - Intergenic
1083750136 11:64756262-64756284 CTGGCACAAGTGGCTGTGGCTGG - Intronic
1087928245 11:103945646-103945668 CTGTCACAAGAAGCTTTCACTGG - Intronic
1091579665 12:1776353-1776375 TTGTCACAAGACCCTGTAGTGGG + Intronic
1094543902 12:31386031-31386053 ATGTTAAAAGAGGCTGTCCTTGG + Exonic
1096396293 12:51269383-51269405 CTGGCACCAGAGGCTTTCCTGGG - Intronic
1100617379 12:96241615-96241637 CTGTCACGAGATCCTGTCATGGG + Intronic
1103916714 12:124379554-124379576 CCGTCACACCAGGCTGTGGTGGG - Intronic
1104442428 12:128805006-128805028 CTGTTAAAAGAGGCTGATGTTGG - Intronic
1112948775 13:104963360-104963382 CAGTCACACGAGGCTGCCTTGGG + Intergenic
1120422016 14:84299391-84299413 CAATCTCAAGAGGCTGTAGTAGG - Intergenic
1121243633 14:92447473-92447495 CTGTCACAAAAGGCTGTAGCAGG - Intronic
1121274175 14:92656637-92656659 GTGTCACCAGAGCCTGCCGTGGG + Intronic
1121407464 14:93727812-93727834 CTGTCACAAAAGGCCTTCATTGG + Intronic
1124400675 15:29345228-29345250 CTGTCTCTAGAGGCTGTATTTGG + Intronic
1126404037 15:48304630-48304652 GGGTCAGCAGAGGCTGTCGTTGG - Intergenic
1129830286 15:78664770-78664792 CTGTCTCAGGAGGCTATCCTTGG + Intronic
1134814282 16:17193256-17193278 CTGTCATTAGACGCTGTGGTAGG + Intronic
1138585853 16:57970089-57970111 CTCCCACGAGAGGCTGTGGTGGG + Intronic
1138799717 16:60013023-60013045 CTGACAGAAGCGGCTGTCGTTGG - Intergenic
1140816396 16:78625013-78625035 CTGGAACAAGAGCCTGTCTTTGG + Intronic
1149821200 17:59779425-59779447 CTGCCAGAAGAGGCTGGCATAGG - Intronic
1161431626 19:4235813-4235835 CAGTTACAAGAGGCTGAGGTGGG + Intronic
1167065656 19:47183927-47183949 CTGTGACCAGAGGGTGTGGTTGG + Intronic
929986115 2:46734384-46734406 CTTTCACAAATGGCTGTCATAGG - Intronic
931719988 2:65060643-65060665 CTGTCAGAAGAGGCTGTACCTGG - Intronic
932574572 2:72955680-72955702 CTACCACAAGAGGCTGTAGTGGG - Intronic
933652629 2:84861657-84861679 CTGTCTGAAGAGGCTGCCGATGG - Intronic
935293827 2:101631106-101631128 CTGTCACAAGAAGCTTTTGTGGG - Intergenic
935428546 2:102947300-102947322 CTGGCAAAATAGGCAGTCGTGGG - Intergenic
938342552 2:130545129-130545151 CAGTCCCAGGAGGCTGTCTTTGG + Intronic
938347280 2:130575580-130575602 CAGTCCCAGGAGGCTGTCTTTGG - Intronic
948358315 2:237398401-237398423 CTGTCACAAGATCTTGTGGTAGG - Intronic
1169384321 20:5135410-5135432 CTGGCACTAGAGGCTGTTGGGGG + Intronic
1170071377 20:12372801-12372823 CTGGCACAAAAGGCTGTCTATGG + Intergenic
1170598914 20:17825959-17825981 CTGGCAAAAGATGCTGTCTTGGG + Intergenic
1172635159 20:36405347-36405369 CTGTCTCAAGGGGCTGTTGAGGG + Intronic
1174349790 20:49958692-49958714 CTTTCACAAGAAGCCGACGTTGG - Intergenic
1176378658 21:6100673-6100695 CTGGCACAAGAGGCTGGCAGTGG - Intergenic
1179744817 21:43437564-43437586 CTGGCACAAGAGGCTGGCAGTGG + Intergenic
1182292627 22:29293117-29293139 CTACCTCAAGAGGCTGTGGTGGG - Intronic
950784967 3:15427111-15427133 CACTCACAAGAGGCTGTCATAGG + Intronic
951696378 3:25449514-25449536 CTGTCACAAGCAGCTGTCCCTGG - Intronic
954521127 3:51227582-51227604 ATGTCACCAGAGGCTGTTCTTGG + Intronic
955350145 3:58187709-58187731 CACTCACTTGAGGCTGTCGTTGG - Intergenic
956259577 3:67323974-67323996 CTGTCCCAAGAGGCTAACATGGG - Intergenic
961492767 3:127266691-127266713 CTGCCACAAGGGGCTGTGGGAGG - Intergenic
963230569 3:142905185-142905207 CTGTTACATGAGGCTGAAGTTGG + Intergenic
964744706 3:160001473-160001495 CTTTCACAAAAGGTTTTCGTGGG + Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966629621 3:182058093-182058115 CTGCCAAAGGAGGCTGTAGTGGG + Intergenic
980578947 4:134723633-134723655 CACACACAAGAGTCTGTCGTGGG - Intergenic
981288335 4:143045822-143045844 CTGTCTGAAGAGGTTGTGGTTGG - Intergenic
984550675 4:181155348-181155370 CTGTCACAGGAGGGTGTCTGTGG - Intergenic
986575459 5:9208374-9208396 CTGCCTCAAGGGGCTGTCCTGGG + Intronic
987688449 5:21235406-21235428 CTGTCTGAAGAGGCTGACATGGG + Intergenic
991554133 5:67876347-67876369 CTGTCACAGGAGCCTCTCCTTGG + Intergenic
991939810 5:71839702-71839724 ATGTGACAAGATGCTGTCCTTGG + Intergenic
1004616116 6:17291019-17291041 CTGTCACAAGAGGCTGTCGTGGG - Intronic
1010761714 6:79731635-79731657 CTTTCACAAGAGGCTTTTGTTGG - Intergenic
1016322812 6:142865906-142865928 CTGTAAGAAGAGGCTGTCTTGGG - Intronic
1019681041 7:2349842-2349864 CTGTCACAGGAGGCTGAGGCAGG - Intronic
1024251300 7:47507770-47507792 CTGGCACAGGAGGCTGTGTTGGG - Intronic
1031698443 7:124891264-124891286 CTGTCACAACAGGCAGTTTTTGG - Intronic
1032932619 7:136690761-136690783 CTGTCACAGGAGCATGTGGTTGG - Intergenic
1036711459 8:11082100-11082122 CTGCCAGAAGATGCTGCCGTCGG + Intronic
1036794018 8:11742666-11742688 CTGTGACAGGAGGCTGTCACGGG - Intronic
1038044297 8:23753167-23753189 CTGCCACAAGGGGCTGTCTGTGG - Intergenic
1045516173 8:102863256-102863278 CTGTCACCAGAGGCCGGCGCGGG + Intronic
1046981015 8:120336502-120336524 CTATCCCAAGAGGCTCTCATTGG + Intronic
1049836056 8:144736168-144736190 CTGTGAGAACAGGCTGTCGAGGG - Intronic
1053623421 9:39843840-39843862 CTGTCACTAGAGGCAGTAGAGGG + Intergenic
1053881447 9:42599388-42599410 CTGTCACTAGAGGCAGTAGAGGG - Intergenic
1053891216 9:42694924-42694946 CTGTCACTAGAGGCAGTAGAGGG + Intergenic
1054220478 9:62406859-62406881 CTGTCACTAGAGGCAGTAGAGGG - Intergenic
1054230237 9:62502313-62502335 CTGTCACTAGAGGCAGTAGAGGG + Intergenic
1056965278 9:91159904-91159926 CTGACACCAGACGCTGTCCTGGG + Intergenic
1057201362 9:93142107-93142129 ATGTCACAAGAGCCTGCAGTGGG + Intergenic
1060643835 9:125261680-125261702 CTGCCCCCTGAGGCTGTCGTGGG - Intergenic
1190299394 X:49047784-49047806 CTGTCATAAGATGTTGTGGTAGG + Intergenic