ID: 1004620298

View in Genome Browser
Species Human (GRCh38)
Location 6:17325491-17325513
Sequence ATATTTGGAGGGCCTCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004620291_1004620298 8 Left 1004620291 6:17325460-17325482 CCTTCCTGGGAGGTGGGGTCAAT No data
Right 1004620298 6:17325491-17325513 ATATTTGGAGGGCCTCTGTAAGG No data
1004620292_1004620298 4 Left 1004620292 6:17325464-17325486 CCTGGGAGGTGGGGTCAATGTGG No data
Right 1004620298 6:17325491-17325513 ATATTTGGAGGGCCTCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004620298 Original CRISPR ATATTTGGAGGGCCTCTGTA AGG Intergenic
No off target data available for this crispr