ID: 1004620879

View in Genome Browser
Species Human (GRCh38)
Location 6:17329261-17329283
Sequence AAATAACCACAGGTCGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004620879_1004620883 4 Left 1004620879 6:17329261-17329283 CCATGCCCGACCTGTGGTTATTT No data
Right 1004620883 6:17329288-17329310 TACAAATCATATAATACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004620879 Original CRISPR AAATAACCACAGGTCGGGCA TGG (reversed) Intergenic
No off target data available for this crispr