ID: 1004628799

View in Genome Browser
Species Human (GRCh38)
Location 6:17401692-17401714
Sequence ATGCAGATCCACAATTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004628799 Original CRISPR ATGCAGATCCACAATTATTT AGG Intronic
902276299 1:15342466-15342488 CTGCAGATCCACATTTTCTTAGG + Intronic
902833250 1:19031227-19031249 ATGCAGAGCCTAAATAATTTAGG + Intergenic
903376744 1:22871207-22871229 ATGCAGAGATACAATTATTCAGG - Intronic
907080736 1:51619248-51619270 ATTCAGATCCACACAAATTTGGG - Intronic
907769811 1:57449719-57449741 AGGCAGATGGTCAATTATTTTGG + Intronic
908124006 1:61012736-61012758 ATGCACATCCAGACTTTTTTTGG + Intronic
910562209 1:88602447-88602469 AGGCAGATCCACCCTTAATTGGG + Intergenic
912033165 1:105274893-105274915 AAGCAGACTCACAATTTTTTTGG + Intergenic
912752452 1:112296959-112296981 ATGCAGATCCAGGTTTTTTTGGG - Intergenic
916094441 1:161336507-161336529 ATACAGATTCAGAATAATTTAGG - Intronic
918268955 1:182877015-182877037 ATATAGATGCACAATAATTTTGG - Intronic
918369427 1:183844161-183844183 ATGCAGGCTGACAATTATTTTGG + Intronic
919138823 1:193544513-193544535 TTCCAAATCCACAGTTATTTAGG + Intergenic
921119492 1:212124510-212124532 AAGCAGATCCACCCTTAATTTGG + Intergenic
923155050 1:231271145-231271167 AAGCAGATGAACAAGTATTTGGG - Intronic
1062845972 10:705447-705469 ATGCAGGTACACAATTTTTATGG + Intergenic
1064650639 10:17505957-17505979 ATACTGACCCAAAATTATTTTGG + Intergenic
1064821663 10:19342448-19342470 AAGAAGCTCCACAATTATTCAGG - Intronic
1065023880 10:21523580-21523602 ATCCAGAACCACAATTTGTTAGG + Intronic
1065453904 10:25886485-25886507 AGACACATCCACAATTATGTTGG - Intergenic
1066692371 10:38043006-38043028 GTTCAAATCCACAATTATTGTGG - Intronic
1069199227 10:65592402-65592424 CTGCAGAACCACAAATATTGTGG + Intergenic
1075771547 10:124941704-124941726 ATGAACATTCACAATTATATTGG + Intergenic
1076270666 10:129149665-129149687 ATGCAGTCACTCAATTATTTGGG - Intergenic
1076311060 10:129507819-129507841 AAGCAGATCCATATTTATTTTGG - Intronic
1077586198 11:3455310-3455332 AAGGAGGTCCAGAATTATTTGGG - Intergenic
1077754887 11:5016208-5016230 ATACAGATTTATAATTATTTAGG - Intergenic
1078113130 11:8416601-8416623 ATGCAGATTCAAAATAATGTAGG - Intronic
1078270505 11:9790030-9790052 AAGCAGTTCCACCATTACTTAGG - Intronic
1080319566 11:30990931-30990953 ATGCAATTCCAAAATAATTTTGG + Intronic
1080392585 11:31861898-31861920 CTGCAGAAACCCAATTATTTAGG + Intronic
1080697540 11:34615910-34615932 ATCCAGATGCCTAATTATTTGGG - Intergenic
1082280440 11:50266076-50266098 AGACAAATCCACAATTACTTTGG + Intergenic
1082294402 11:50421131-50421153 ATGTAGATGCACAATAGTTTTGG - Intergenic
1087374338 11:97323045-97323067 AGGCAGATCCACCATTAGTATGG + Intergenic
1087414187 11:97831683-97831705 ATGCACATCCTGAAATATTTAGG - Intergenic
1091043563 11:132305099-132305121 ATGCAGTTACACAAATATTAAGG - Intronic
1094112353 12:26875064-26875086 ATGCAAACTCAAAATTATTTTGG + Intergenic
1095654414 12:44651939-44651961 ATGCAGATCCAAAATTAATAGGG + Intronic
1097518569 12:60638504-60638526 AGGCAGATCCACACTTAATCTGG + Intergenic
1098204621 12:68095028-68095050 ATGCATATTCCTAATTATTTTGG - Intergenic
1099426166 12:82525294-82525316 ATGCAGTTCTATAACTATTTTGG + Intergenic
1100137991 12:91578673-91578695 ATGCACATAAACACTTATTTTGG - Intergenic
1106044191 13:26122427-26122449 AATCAGATCCACAAATAATTTGG + Intergenic
1106112225 13:26787038-26787060 ATGCAGATCCAAATTCATTTTGG + Intergenic
1109932027 13:69228348-69228370 ATGCATATCCACAATTAACAAGG - Intergenic
1110696932 13:78502050-78502072 ATCCAGATCCAGAATTATTCAGG + Intergenic
1110948072 13:81449486-81449508 ATGCAAATGCACATTTAATTTGG - Intergenic
1110979801 13:81881796-81881818 ATGCAAATCCATAATTGTCTTGG - Intergenic
1111170764 13:84523534-84523556 ATGGAGAGGCATAATTATTTGGG - Intergenic
1111282751 13:86048947-86048969 AGGCAGATCCACCATTAATCTGG - Intergenic
1113377496 13:109779236-109779258 ATGCTGATGCAGAATAATTTTGG - Intronic
1114753638 14:25233964-25233986 AAGCAGGTTCACATTTATTTAGG - Intergenic
1115492124 14:33967716-33967738 ATTCAAATCCACAATGATTTGGG - Intronic
1115651666 14:35406336-35406358 ATGCAAATCTACAATGATTGAGG + Intergenic
1115822921 14:37231443-37231465 ATGCAGAACTTCCATTATTTTGG - Intronic
1116400569 14:44501319-44501341 ATATATATCCACATTTATTTAGG - Intergenic
1116645477 14:47523294-47523316 ATGTATATCCAGAACTATTTTGG - Intronic
1116728263 14:48589977-48589999 AAGCATATCAACAATTATTTAGG - Intergenic
1120671764 14:87370628-87370650 ATGCAGATGCACGATTTTGTAGG - Intergenic
1121939738 14:98058765-98058787 ATGCAGATCCACCCTTAATCTGG + Intergenic
1123209217 14:106742414-106742436 ATGCAGATCCACAGGTTTTCAGG + Intergenic
1125902105 15:43357931-43357953 ATCCATATCCACAATAAATTAGG - Intergenic
1126598913 15:50408876-50408898 ATGTTCATACACAATTATTTTGG - Intergenic
1127562782 15:60156909-60156931 ATGCTTTTCCTCAATTATTTGGG + Intergenic
1130614712 15:85393981-85394003 ATACAGTTCCACAATTCTATTGG - Intronic
1131137320 15:89947714-89947736 ATTCAAATCCTCATTTATTTTGG - Intergenic
1132400233 15:101500685-101500707 ACCCAGATGCAAAATTATTTGGG - Intronic
1133901228 16:9976987-9977009 AATCAGAACCAAAATTATTTTGG - Intronic
1138860338 16:60748554-60748576 ATCAAGATCCAAAAATATTTTGG + Intergenic
1140179955 16:72705579-72705601 ATGTTGATCTATAATTATTTTGG - Intergenic
1142722662 17:1787092-1787114 ATCCAGTTCCACAAATATTTGGG - Intronic
1143072284 17:4306636-4306658 AAGCAAAACCACAAATATTTTGG - Intronic
1143792706 17:9310785-9310807 ATTCAGATCTACACTGATTTTGG + Intronic
1145978977 17:29000568-29000590 ATCCAGAACCACAATAATTCAGG - Intronic
1148449151 17:47763314-47763336 AGACAAATCCACAATTATATTGG - Intergenic
1150987592 17:70215521-70215543 ATGCAAATGCACAATATTTTTGG - Intergenic
1153494193 18:5680937-5680959 AGGCAGATCCACCCTTATTCTGG - Intergenic
1154252241 18:12754282-12754304 AGGCAGATCCACCCTTAATTTGG - Intergenic
1154938986 18:21092032-21092054 ATGCAGATTTTCAATTATTAGGG + Intronic
1155736257 18:29226330-29226352 ATGCAGATCAACAATCAGGTGGG + Intergenic
1156781627 18:40857483-40857505 ATAAAGATCAGCAATTATTTAGG - Intergenic
1157004586 18:43566855-43566877 CTGCATATCCACAAATCTTTTGG - Intergenic
1159168492 18:64732138-64732160 ATGCAGACACACATTTAATTTGG - Intergenic
1159224145 18:65509948-65509970 ATGGAAAAACACAATTATTTGGG - Intergenic
1159432675 18:68375292-68375314 TTGCAAATTTACAATTATTTGGG + Intergenic
1159879373 18:73844188-73844210 AGGCAGGTCCACAAACATTTTGG - Intergenic
1162886515 19:13701702-13701724 AGGCAGCTCCACAATTATCAAGG + Intergenic
1164235663 19:23331095-23331117 GTGCAAATACACAAATATTTAGG - Intronic
1168690450 19:58373525-58373547 ACTCAGATCCACAAGTGTTTGGG - Intronic
927121896 2:19972519-19972541 ATGCAGATTTTTAATTATTTAGG + Intronic
927447969 2:23182274-23182296 AGACAAATCCACAATTATATTGG + Intergenic
928752197 2:34483735-34483757 ATGAAGATACACATTTCTTTTGG + Intergenic
929368497 2:41192034-41192056 ATGGAGATCAACCATAATTTGGG - Intergenic
931570420 2:63663254-63663276 ATGCAGGACGACTATTATTTTGG + Intronic
932994937 2:76840293-76840315 ATGTATCTCCACAATTGTTTGGG + Intronic
934904786 2:98189402-98189424 AGGAAAATCCACAAATATTTGGG - Intronic
935072437 2:99706681-99706703 AGGCAGACCCATAATTAATTTGG + Intronic
936632205 2:114215733-114215755 ATGAAAATCCACACTTCTTTTGG + Intergenic
936936826 2:117846954-117846976 TTGCAAAACCACAATTAATTTGG + Intergenic
939806539 2:146780932-146780954 AGGCAGACCCACACTTATTCTGG + Intergenic
940731924 2:157402901-157402923 CTGCAGAACCACAAATATTGTGG + Intergenic
941975667 2:171402278-171402300 ATTCATATCCAGAATTATTTAGG - Intronic
943730818 2:191301630-191301652 TTGCAGATACAAAATTATCTTGG - Intronic
945212037 2:207393756-207393778 ATGCAGATTCACATTTAGTCAGG + Intergenic
947325196 2:228966992-228967014 TTCCAGATCCAGAATAATTTGGG + Intronic
947993012 2:234501663-234501685 ATAGAGATCGACAATTATTAAGG - Intergenic
1171395003 20:24826673-24826695 ATGCAGAACCTCCATTCTTTGGG - Intergenic
1171944888 20:31367798-31367820 AGACAGATCTACAATAATTTGGG - Intergenic
1171965318 20:31525397-31525419 ATGGAGACTCACAAATATTTTGG - Intronic
1176940981 21:14925741-14925763 TTGCACATCAACAATTATTTAGG - Intergenic
1177720098 21:24894765-24894787 ATGCAGAAGCAAATTTATTTGGG + Intergenic
1177749641 21:25264058-25264080 AAGCAGATCAACAGTTTTTTAGG + Intergenic
1181310635 22:21942807-21942829 ATGCAGATCCACCCTGATTCTGG + Intronic
1184983486 22:48113406-48113428 ATGCATCCCCAGAATTATTTGGG - Intergenic
949824917 3:8155267-8155289 ATGCAGAACCACTATTATTAAGG + Intergenic
949885327 3:8688427-8688449 CTGCATGTCCACAATTATCTTGG - Intronic
950235764 3:11318956-11318978 AAGCAAATCAACAATTACTTTGG - Intronic
950314482 3:11988428-11988450 ATGCAAATCAAAAATTATTCAGG + Intergenic
950986259 3:17371459-17371481 ACTCAGAGCCATAATTATTTAGG - Intronic
955290978 3:57692539-57692561 ATGAACATCAACAAGTATTTAGG + Intronic
956652718 3:71520117-71520139 ATGCATCTCCCCAATTATCTTGG + Intronic
956946175 3:74226140-74226162 ATATAAATCAACAATTATTTTGG + Intergenic
957069133 3:75552007-75552029 AAGGAGGTCCAGAATTATTTGGG + Intergenic
957152460 3:76503285-76503307 AGGCAGATCCACCGTTATTCTGG - Intronic
957430730 3:80102407-80102429 ATGAAGAAACACAATTATCTTGG - Intergenic
963739237 3:149058382-149058404 ATGCTGATTCAGAATTATTGGGG - Intronic
965019414 3:163208449-163208471 ATGTAGATACACATTTAATTTGG - Intergenic
965334629 3:167421140-167421162 ATGCAGATACATTATTATTATGG + Intergenic
965363814 3:167774390-167774412 ATGCAGATACACTTTTATCTTGG - Intronic
967436397 3:189451829-189451851 AGGCAGCTCCACAACTTTTTAGG - Intergenic
969001389 4:3985264-3985286 AAGGAGGTCCAGAATTATTTGGG - Intergenic
969752627 4:9123434-9123456 AAGGAGGTCCAGAATTATTTGGG + Intergenic
969812529 4:9659598-9659620 AAGGAGTTCCAGAATTATTTGGG + Intergenic
970073630 4:12192965-12192987 ATGCATATTCACTAATATTTAGG - Intergenic
970782527 4:19755571-19755593 ATGAAGATCCTCGATTATCTGGG + Intergenic
971310431 4:25521508-25521530 ATGCAGATTCAAAACTCTTTGGG + Intergenic
972556397 4:40185798-40185820 ATGCACAGCTACAATAATTTAGG + Intergenic
973819870 4:54653380-54653402 ATGTAGCTCCACAATACTTTTGG + Intergenic
977446052 4:97134206-97134228 CTGCATATCCATAATTATTCAGG + Intergenic
977694850 4:99954124-99954146 AGGCAAATACACTATTATTTAGG - Intergenic
979362061 4:119776376-119776398 AGGCAGATCCACACTTAATCTGG + Intergenic
979550043 4:121980313-121980335 ATGTAGATTCATAATTACTTAGG - Intergenic
979861729 4:125701693-125701715 AACCAAATCCACCATTATTTGGG - Intergenic
980254108 4:130354064-130354086 ATGCAGAAACACAATAATCTGGG - Intergenic
981267922 4:142808894-142808916 TAACAAATCCACAATTATTTAGG - Intronic
981931048 4:150189777-150189799 ATGCAGAGCCACAGTTCATTTGG + Intronic
982601502 4:157456606-157456628 ATGCAAATCCACAAAAAGTTAGG - Intergenic
982847343 4:160270729-160270751 AGACAGATCCACACTTATTCTGG + Intergenic
983295130 4:165857273-165857295 ATGTAGATCCAGAATTATATGGG + Intergenic
983761855 4:171419356-171419378 ATCCAGATCCTGAATTTTTTGGG + Intergenic
983877340 4:172892882-172892904 CAGGAAATCCACAATTATTTGGG + Intronic
984002928 4:174272483-174272505 ATGCAGATCCACAAATACTGAGG + Intronic
987176921 5:15321445-15321467 CTGCAGATAAACACTTATTTAGG - Intergenic
990089992 5:52031930-52031952 ATTAAGCTCCACAATCATTTTGG - Intronic
994442281 5:99824040-99824062 ATGCATTTCTCCAATTATTTAGG + Intergenic
996774070 5:127115914-127115936 CTGCAGAGCCACAATTCTTAGGG - Intergenic
997077611 5:130698734-130698756 ATGCTGCTCCATAACTATTTTGG - Intergenic
998902293 5:146869083-146869105 ATTCAAATCCACAATGGTTTTGG + Intronic
999752890 5:154643000-154643022 AAGGAGGTCCAGAATTATTTGGG - Intergenic
1000797436 5:165682504-165682526 ACACAGATCCACAATGTTTTGGG + Intergenic
1002623118 5:180504390-180504412 ATTCAGATACACAATGACTTGGG - Intronic
1003289835 6:4770986-4771008 ATACATATACACAAATATTTAGG - Intronic
1003986960 6:11444939-11444961 TTGAAAATCCACAAATATTTGGG - Intergenic
1004628799 6:17401692-17401714 ATGCAGATCCACAATTATTTAGG + Intronic
1004721242 6:18269210-18269232 ATGAAGATCCAGAATTTTTTTGG + Intergenic
1005141826 6:22641219-22641241 AGGCAGACCCACACTTAATTTGG + Intergenic
1005581924 6:27243353-27243375 AAGCAAACCCACAATTTTTTGGG + Intergenic
1005741858 6:28799372-28799394 AGACAAATCCACAATTACTTTGG + Intergenic
1006666640 6:35699428-35699450 ATTCAGATACACAGTTATCTGGG + Intronic
1009406510 6:63320461-63320483 ATGAAGGTCCAGAATTAATTTGG - Intergenic
1011230526 6:85156657-85156679 ATTTACATCCTCAATTATTTAGG + Intergenic
1011311752 6:85987602-85987624 ATGCACATCTCCAATTCTTTGGG + Intergenic
1013432050 6:110064120-110064142 ATGCAGTCCCACAGTCATTTTGG - Intergenic
1014832436 6:126118914-126118936 AAGCAGAATGACAATTATTTAGG + Intergenic
1018255128 6:161910998-161911020 AAGCAAGTCCACAGTTATTTTGG - Intronic
1019009853 6:168835516-168835538 ATAAAGATGCACAATTATTATGG - Intergenic
1020487660 7:8738949-8738971 AGGAACATCCACAATTATTGAGG - Intronic
1020535749 7:9395300-9395322 ATCCACATCCACAATTTTTAAGG - Intergenic
1023625383 7:42110314-42110336 ATGGAGATGCACCTTTATTTGGG - Intronic
1024186172 7:46950324-46950346 ATGGAGATGCACAATTTTCTTGG - Intergenic
1024460966 7:49658955-49658977 ATGGAGGTCCACAATTTTCTAGG - Intergenic
1024914327 7:54482406-54482428 ATGCCGAGTCACAAATATTTGGG - Intergenic
1026469529 7:70683084-70683106 ATGCACATACAGAATTATTTGGG + Intronic
1026525225 7:71147450-71147472 AGGCAGATCCACCCTTAATTTGG - Intronic
1028031626 7:85922262-85922284 ATACAGATTCAAAATTATTTGGG - Intergenic
1028910462 7:96202092-96202114 AAGCAGATTGACCATTATTTTGG - Intronic
1030276998 7:107732422-107732444 AGGCAGACCCACCATTAATTTGG + Intergenic
1031401077 7:121327144-121327166 ATACTGATCCAGAAATATTTTGG - Intronic
1031497842 7:122473020-122473042 ATGCAGATGCTCAAATATTTTGG - Intronic
1032918894 7:136523864-136523886 CTGTAGATCCACATTTAGTTAGG + Intergenic
1033454805 7:141493053-141493075 ATGGAGATTCACAATTACCTTGG - Intergenic
1034003780 7:147445721-147445743 ATGCAGCTTCTCAGTTATTTTGG - Intronic
1036734915 8:11304425-11304447 AAGCACATCCACAATTATCACGG - Intronic
1036853686 8:12224315-12224337 AAGGAGGTCCAGAATTATTTGGG - Intergenic
1036875062 8:12466825-12466847 AAGGAGGTCCAGAATTATTTGGG - Intergenic
1037188591 8:16094473-16094495 ATGGACATCCACTATCATTTAGG - Intergenic
1037264577 8:17044597-17044619 ATGAAGATCCACATTGCTTTTGG - Intronic
1038448516 8:27622106-27622128 ATACAGATCCAAGTTTATTTGGG - Intergenic
1041604706 8:59767858-59767880 AAAAATATCCACAATTATTTAGG + Intergenic
1041846816 8:62338858-62338880 AGGCAGATCCACCCTTAATTTGG - Intronic
1043106747 8:76123562-76123584 GTGCACCTCCCCAATTATTTGGG + Intergenic
1043129561 8:76444097-76444119 ATGCTGATCGAAAAATATTTGGG - Intergenic
1044559557 8:93599073-93599095 ATGCACATATACAATTATTTTGG + Intergenic
1045059040 8:98396339-98396361 CTGCAGATACACAATTGCTTTGG - Intergenic
1045316191 8:101045775-101045797 TTTCAGATCCACAATTCTTGGGG + Intergenic
1045989536 8:108289426-108289448 AAGCACTTCCACAAGTATTTAGG + Intronic
1046586241 8:116151390-116151412 AGGCAGATCCACCCTTAATTTGG - Intergenic
1048295058 8:133207929-133207951 AAGCAGCTAGACAATTATTTGGG - Intronic
1050884565 9:10747842-10747864 ATGCAGATCTACGTTTATTCTGG + Intergenic
1051145564 9:14023689-14023711 TTGCAGCTTCACATTTATTTAGG + Intergenic
1051231409 9:14959129-14959151 CTGCAGATCCACACTGATTCTGG - Intergenic
1051505843 9:17826744-17826766 AGGCAGATCCACCCTTAATTTGG - Intergenic
1051617561 9:19020657-19020679 ATGAAGATTCAAAATTATCTTGG - Intronic
1052262810 9:26537323-26537345 ATGCATGTCCACAAAAATTTTGG - Intergenic
1053039726 9:34859716-34859738 AGGCAGACCCATAACTATTTAGG + Intergenic
1055778496 9:79793182-79793204 AGGGAGTTCCACAACTATTTAGG + Intergenic
1058628173 9:106957756-106957778 ATGCAGATCTAGAAATATTTTGG + Intronic
1060710605 9:125860098-125860120 ATACAGATCCACAATGAATATGG - Intronic
1061140902 9:128765885-128765907 ATGCAGACACACAATAATTGGGG + Intronic
1186271358 X:7891821-7891843 ATGCACATCCTCAATAATTGTGG - Intergenic
1186320497 X:8419156-8419178 ATACAGAACCACAATTCTTTAGG - Intergenic
1186368413 X:8920414-8920436 AAGCAGACCCACCATTAATTTGG + Intergenic
1186918400 X:14248638-14248660 ATGCTGATCAACAACTATTTAGG + Intergenic
1186965847 X:14785474-14785496 ATGCTGATACACAATTAGGTTGG - Intergenic
1188575320 X:31641885-31641907 ATGCACATCCACAAAGATTTGGG - Intronic
1188706529 X:33339623-33339645 TTGCAGATCCACTGTTTTTTAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1193214882 X:78852155-78852177 ATGCAGACACACAAGTACTTAGG - Intergenic
1193237410 X:79124892-79124914 AAGCATGTTCACAATTATTTTGG - Intergenic
1193262522 X:79425334-79425356 AAGCAGACCCACACTTAATTTGG - Intergenic
1193848382 X:86503568-86503590 ATGCAGATCCACAATGGTCATGG + Intronic
1194374363 X:93113421-93113443 ATGCAGATATACCATTCTTTGGG + Intergenic
1194877827 X:99210952-99210974 ATGCAGTTTCTCAATTATTGAGG + Intergenic
1195145229 X:102007595-102007617 ATGCACATACACACTTATATAGG - Intergenic
1195169285 X:102250079-102250101 AGACACATCCACATTTATTTTGG + Intergenic
1195189572 X:102437009-102437031 AGACACATCCACATTTATTTTGG - Intronic
1195895473 X:109741902-109741924 ATGCCCAGCCTCAATTATTTTGG - Intergenic
1197337103 X:125221592-125221614 AACCATATCCACCATTATTTTGG - Intergenic
1198842546 X:140874079-140874101 ATGCATATCTCCATTTATTTAGG - Intergenic
1200682393 Y:6227489-6227511 ATGCAGATATACCATTCTTTGGG + Intergenic
1201405640 Y:13646910-13646932 ATGCACATGTACAATTATTGTGG - Intergenic
1201851091 Y:18480710-18480732 TTGAATATTCACAATTATTTAGG + Intergenic
1201882228 Y:18839668-18839690 TTGAATATTCACAATTATTTAGG - Intergenic