ID: 1004634995

View in Genome Browser
Species Human (GRCh38)
Location 6:17458277-17458299
Sequence CAGGATAAAGAGAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2105
Summary {0: 1, 1: 1, 2: 27, 3: 213, 4: 1863}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004634992_1004634995 -6 Left 1004634992 6:17458260-17458282 CCCAGCAATCAGGCTACCAGGAT 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG 0: 1
1: 1
2: 27
3: 213
4: 1863
1004634993_1004634995 -7 Left 1004634993 6:17458261-17458283 CCAGCAATCAGGCTACCAGGATA 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG 0: 1
1: 1
2: 27
3: 213
4: 1863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004634995 Original CRISPR CAGGATAAAGAGAAAGAAGA TGG Intronic
Too many off-targets to display for this crispr