ID: 1004636446

View in Genome Browser
Species Human (GRCh38)
Location 6:17472613-17472635
Sequence CAATGGCAAGAGAATTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004636441_1004636446 -4 Left 1004636441 6:17472594-17472616 CCTTTTCCTATGAGCCTTCCAAT 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1004636446 6:17472613-17472635 CAATGGCAAGAGAATTACCTTGG 0: 1
1: 0
2: 1
3: 15
4: 245
1004636443_1004636446 -10 Left 1004636443 6:17472600-17472622 CCTATGAGCCTTCCAATGGCAAG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1004636446 6:17472613-17472635 CAATGGCAAGAGAATTACCTTGG 0: 1
1: 0
2: 1
3: 15
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004636446 Original CRISPR CAATGGCAAGAGAATTACCT TGG Intronic
903630628 1:24766965-24766987 CACTGGAAGAAGAATTACCTTGG + Intronic
904007589 1:27371721-27371743 CAATGGAAATAGAAGTACTTAGG - Intronic
904894902 1:33808996-33809018 TAATGGCTAGAGAATTATTTTGG - Intronic
906081960 1:43097303-43097325 CAATGGCTACAAAAATACCTAGG + Intergenic
907687159 1:56623358-56623380 CAATGGCCTGAGATGTACCTTGG - Intronic
909120338 1:71595297-71595319 CAGAGGGAAGAAAATTACCTCGG - Intronic
909496903 1:76288981-76289003 CAATGGCATGAGACGTACTTTGG - Intronic
911725064 1:101234392-101234414 CAATGGGAAGAGACTTATATGGG + Intergenic
912880639 1:113409542-113409564 CTGAGGCAAGAGAATCACCTGGG + Intronic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
914855783 1:151349422-151349444 CAAAGGCAAGAGGATTGCTTGGG + Intergenic
915447580 1:155982863-155982885 TAAAGGCAAGAGGATTTCCTGGG + Intronic
916917490 1:169425110-169425132 CAATGGCAAGACATTTCCATAGG + Intronic
917264821 1:173209895-173209917 CTATGGGAAGATAATTACTTTGG - Intergenic
917668208 1:177246219-177246241 ACAAGGCAAAAGAATTACCTGGG + Intronic
917891796 1:179446548-179446570 CACTGGCAACAGAATCACCTGGG - Intronic
919346613 1:196388182-196388204 CGATGCCAAGTTAATTACCTTGG - Intronic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
922627402 1:227062654-227062676 AAATGCCATGAGAAATACCTAGG - Intronic
1063077087 10:2728150-2728172 CATTGGGAAGAGAACTCCCTTGG - Intergenic
1064394805 10:14973354-14973376 CAGGGGCAAGAGAAAGACCTTGG - Intronic
1065138878 10:22701247-22701269 GAATGGTAAGAAAATGACCTAGG + Intronic
1066259824 10:33718740-33718762 CAGGGGCAACAGCATTACCTGGG - Intergenic
1068170572 10:53388303-53388325 AAATGGAAAGGGAATGACCTTGG + Intergenic
1068544475 10:58330411-58330433 CAGTGGAAAGAGTATAACCTTGG - Intergenic
1068594089 10:58883709-58883731 CAATGTCAAGAAAATTGCCCCGG + Intergenic
1069158553 10:65059601-65059623 CAATGGCTACAAAAATACCTAGG - Intergenic
1070801725 10:79247820-79247842 CAATAGCATCAGAATTATCTGGG - Intronic
1071950684 10:90700046-90700068 AAATGGCAAGATGATTACATTGG - Intergenic
1071968957 10:90882941-90882963 CACTGGCTTTAGAATTACCTGGG + Intronic
1072367787 10:94731857-94731879 GAATTGCAAAAGAAATACCTAGG + Intronic
1073976543 10:109108181-109108203 AAATGGCAAGAAAATCACTTGGG - Intergenic
1074654985 10:115574696-115574718 CAATGGCCAGAGAATTTCTAGGG - Intronic
1074841819 10:117360273-117360295 CATAGTCAAGAGAATTACTTTGG - Intronic
1075351165 10:121726278-121726300 CAAGGGTAAGAGAATTGACTTGG - Intergenic
1075740134 10:124690402-124690424 CAACTGCAAGAGCATGACCTTGG - Intronic
1077981381 11:7303961-7303983 CAATGAAAAGAGAGTGACCTAGG - Intronic
1078436550 11:11330358-11330380 CAATAGCAAGAGTATTTGCTGGG - Intronic
1078914601 11:15767391-15767413 CACTGGAAAAAGAATGACCTTGG + Intergenic
1079127307 11:17726984-17727006 CAATGGCTACATAATTCCCTGGG + Intergenic
1081504606 11:43702872-43702894 AACTGGAAAGAGAATTACCTTGG - Intronic
1084709278 11:70834090-70834112 CAATGCCAAGAAAATTCCCAGGG + Intronic
1085207256 11:74743323-74743345 GATTTGCAAAAGAATTACCTAGG + Intergenic
1085746071 11:79115405-79115427 GAATGGAAAGAGAATTACTAAGG - Intronic
1086338766 11:85826183-85826205 TAATGTCAAAAGAATCACCTGGG - Intergenic
1088337122 11:108718002-108718024 CAATGACAAAAAAATTAGCTGGG + Intronic
1089076216 11:115740938-115740960 CAATGTCCAGAGAATTAAATAGG - Intergenic
1089929598 11:122297094-122297116 CAAGGGCAAGAGAGTGGCCTGGG - Intergenic
1091541416 12:1465944-1465966 CAGTGGCAACAGAATTAGCCTGG - Intronic
1092394714 12:8115478-8115500 CAATGGCATGAGGCTTACCAAGG + Intergenic
1092702987 12:11253787-11253809 AGATGGCAAGTGAATTACTTAGG - Intergenic
1095345892 12:41148319-41148341 CAATGGCATGAGCTGTACCTTGG + Intergenic
1095866487 12:46978386-46978408 CTATGGAAAGAGAATAAACTGGG + Intergenic
1096099661 12:48962195-48962217 CCAAGGCAAGAGAATTGCTTGGG + Intergenic
1099009617 12:77276474-77276496 CAATAGCATGAGAATTCCCTGGG + Intergenic
1099918923 12:88932873-88932895 GACTGGCATGAGAATTACCTGGG - Intergenic
1100382621 12:94075660-94075682 GAATGGCAAGAAAATAAACTGGG - Intergenic
1101032836 12:100676985-100677007 CAATGCCAAGAGGACTACTTTGG + Intergenic
1103242185 12:119422884-119422906 CAATGGCAAGTGAATTTCAATGG + Intronic
1105320376 13:19314427-19314449 CACTGGCAAGAGAACTCCATTGG + Intergenic
1105358722 13:19686270-19686292 CAAGGGGGAGAAAATTACCTGGG + Intronic
1105914503 13:24900547-24900569 CTGAGGCAAGAGAATCACCTGGG + Intronic
1109590050 13:64466934-64466956 CAATGGCAAGTGCATTACACAGG - Intergenic
1109599674 13:64608551-64608573 AATTTGCAAGAGAATTCCCTAGG + Intergenic
1111436123 13:88210557-88210579 CAATGGCAAGAGAATCAAGTAGG + Intergenic
1114220842 14:20694983-20695005 CCATGACAAGAGAATATCCTGGG - Intronic
1114285133 14:21234500-21234522 CATTGGCAATATAATTTCCTTGG + Intronic
1115575076 14:34703328-34703350 AAATAGCAAAAGAAGTACCTGGG - Intergenic
1116272171 14:42786179-42786201 CAATGGCATGAGCTGTACCTTGG - Intergenic
1116494518 14:45544869-45544891 CAACGGCCAGAGCAGTACCTTGG - Intergenic
1117632720 14:57710199-57710221 CAATGGCCTGAGCAGTACCTTGG - Intronic
1120355838 14:83432431-83432453 CAGCAGCAAGAGTATTACCTAGG - Intergenic
1120506121 14:85355105-85355127 CAGTGGCATCAGTATTACCTAGG - Intergenic
1121828476 14:97029676-97029698 CAATGTCAAAACAATTACCATGG - Intergenic
1122465837 14:101932954-101932976 CATTTGCTAGAGAATCACCTGGG - Intergenic
1122672366 14:103382591-103382613 CATTGGCCAGAGAAGTAGCTGGG - Intergenic
1122765526 14:104066817-104066839 CAATGGCCAGAGCTGTACCTTGG + Intergenic
1129580117 15:76799874-76799896 CCATGGCAAGATAGTTCCCTGGG - Intronic
1132024158 15:98390766-98390788 CAATGGGAAGAGGTTGACCTGGG - Intergenic
1135665305 16:24330640-24330662 CACTTGCATGAGAATCACCTGGG - Intronic
1135748441 16:25037077-25037099 CACTGCCAAGAGAATTACTGAGG - Intergenic
1135758171 16:25115303-25115325 CACTGTCAACAGAATTACCGAGG - Intronic
1137662905 16:50224990-50225012 CAATGGTAAGATATTTTCCTTGG + Exonic
1139156238 16:64446326-64446348 GAAAGGCAATAGAATCACCTAGG + Intergenic
1139415450 16:66804792-66804814 AAATGGCAAGAGAAGTCTCTGGG - Intronic
1140699817 16:77571609-77571631 TAATGGCAATAGAAATACATTGG + Intergenic
1142909916 17:3080066-3080088 CAATGGCCTGAGCTTTACCTTGG + Intergenic
1142924588 17:3223743-3223765 CAATGGCCTGAGCTTTACCTTGG - Intergenic
1144434480 17:15228087-15228109 AAATGCCAAGAGTGTTACCTGGG + Intergenic
1145040602 17:19575319-19575341 TAATGGCACGAGAATAAGCTTGG - Intronic
1146724169 17:35144081-35144103 CAGTGGAAAAAGAATTGCCTTGG - Intergenic
1149096216 17:52844205-52844227 CAATGGAAACAGAAATAACTTGG - Intergenic
1149947570 17:60947104-60947126 CAATGGGAAAAAAATTACCAAGG - Intronic
1154017525 18:10632630-10632652 CCATGGCATGAGAAGTATCTGGG + Intergenic
1154187339 18:12196967-12196989 CCATGGCATGAGAAGTATCTGGG - Intergenic
1157941493 18:51933675-51933697 CAATTGATATAGAATTACCTGGG + Intergenic
1158006029 18:52672832-52672854 CAAAGGCAAGAGGATCACTTTGG + Intronic
1158567685 18:58568978-58569000 CCAAGGCAAGAGAATCACTTGGG + Intronic
1159357752 18:67358783-67358805 CAATGGCTAGAGCCCTACCTTGG - Intergenic
1159728734 18:71997546-71997568 CACTTGCAGGAGAATCACCTTGG - Intergenic
1160945680 19:1642704-1642726 CCAAGGCAAGAGGAGTACCTGGG - Intronic
1166171484 19:41030370-41030392 CAATGGAAAGGGATTTTCCTGGG - Intergenic
925153719 2:1634801-1634823 CCATGGCAAGAGAAGTGCCCGGG + Intronic
925524831 2:4787968-4787990 CAATGGCCAGAGCTGTACCTTGG + Intergenic
926575693 2:14578050-14578072 CAATGGGAAGAGGATTTGCTAGG - Intergenic
927744200 2:25601300-25601322 AAATAGAAAGAGAATTACTTGGG - Intronic
928590359 2:32808387-32808409 CAATGGCCAGTGAAATAGCTGGG - Intronic
939160331 2:138580810-138580832 CAATGGCTAGAGTATATCCTCGG - Intergenic
941017569 2:160374375-160374397 CAAAAGCCAGAGAATTACCCTGG + Intronic
941888377 2:170552925-170552947 CAATGGCTTGAGCAGTACCTTGG - Intronic
942762693 2:179418489-179418511 AAAAGACAAAAGAATTACCTAGG + Intergenic
946292050 2:218752937-218752959 CAATGGGAACAGAAATACCATGG + Exonic
948812882 2:240493931-240493953 CAATGGCATGAAAATTCTCTGGG + Intronic
1169365755 20:4990877-4990899 CTGAGGCAAGAGAATCACCTGGG + Intronic
1169730979 20:8785356-8785378 CAGTGGCAAGAGCATCACCAGGG - Intronic
1170712824 20:18807698-18807720 CAATGGCCAGAGAAAGCCCTGGG - Intergenic
1170903082 20:20485117-20485139 CATTGGAAAAAGAATTATCTTGG - Intronic
1171284957 20:23929396-23929418 CAAGGGCATGAGAAGGACCTAGG - Intergenic
1171476256 20:25411282-25411304 AAAAGGTAAGAAAATTACCTTGG + Intronic
1171723933 20:28597374-28597396 CAATGGAAGGAGAATTGTCTTGG - Intergenic
1172218644 20:33255800-33255822 AAATGACAAGAGAATTAAATGGG + Intergenic
1173340239 20:42146737-42146759 CAATGGCAAGAGGAATCACTGGG - Intronic
1175528138 20:59650694-59650716 AAGTGGCAAGAGAATTATCCAGG + Intronic
1176903811 21:14476082-14476104 CAATGGCAATAGCATGATCTCGG - Intergenic
1177110892 21:17026998-17027020 TAATGGCATTAAAATTACCTGGG + Intergenic
1178329303 21:31673425-31673447 CAATGGTAAGAAAAATACTTGGG + Intronic
1178943747 21:36929102-36929124 CACTCACAAGAGAATAACCTGGG + Intronic
1180297488 22:10956054-10956076 CAATGGAAGGAGAATTGTCTTGG - Intergenic
1180639394 22:17286279-17286301 CTGAGGCAAGAGAATCACCTGGG - Intergenic
1184943873 22:47787368-47787390 CAATGGCCTGAGATGTACCTTGG - Intergenic
949450755 3:4182298-4182320 AAATGCCAATAGAATAACCTAGG - Intronic
950957583 3:17070932-17070954 CCAAGGCTTGAGAATTACCTGGG + Intronic
950959284 3:17088233-17088255 CAATGGGTAGGGACTTACCTTGG - Intronic
951083349 3:18479157-18479179 CACTGGAAAAAGAATTGCCTTGG - Intergenic
951357260 3:21683097-21683119 CAATAGCATCAGCATTACCTAGG - Intronic
951789456 3:26463632-26463654 CAATGTCAAGAGCATGATCTTGG + Intergenic
952734293 3:36673637-36673659 TAATACCCAGAGAATTACCTGGG - Intergenic
958256411 3:91330845-91330867 AAATGTCTAGAGATTTACCTGGG + Intergenic
958583899 3:96061491-96061513 CAATGGCCTGAGATGTACCTTGG - Intergenic
960010592 3:112830473-112830495 CAATGACAAGAGTATAACGTAGG - Intronic
960032711 3:113070833-113070855 CCATGGCAAGAGGATTACAGAGG + Intergenic
961617406 3:128193704-128193726 CAATGGCAAGTGACTTGCCTAGG + Intronic
962598921 3:136975979-136976001 CAGTGGCAGGATAATTATCTGGG + Intronic
963135896 3:141903744-141903766 TAACTGCAAGATAATTACCTGGG - Exonic
963223552 3:142837329-142837351 CAATGGGAAAAGAATTATCTAGG + Intronic
963332926 3:143935892-143935914 CACTGGAAAGAGAATCATCTTGG - Intergenic
964372543 3:156016109-156016131 GTATGGCATGAGCATTACCTAGG + Intergenic
964920232 3:161887142-161887164 CAATGGCAATACCATTGCCTTGG + Intergenic
965111789 3:164433846-164433868 CCATGGCAGGAGAATTCCTTTGG + Intergenic
965689332 3:171338734-171338756 CCAAGGCAAGTGAATTCCCTGGG - Intronic
966346914 3:178990379-178990401 CAATGGCCAGAGCTATACCTTGG + Intergenic
966574542 3:181484969-181484991 CAATGCTATGGGAATTACCTAGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968152925 3:196353143-196353165 CAATGAGAAGAGAATCATCTGGG + Exonic
971610712 4:28722629-28722651 CAATGGAAAGATCAGTACCTAGG + Intergenic
971871840 4:32251018-32251040 CAGTGGCAAGGTAATTAGCTGGG - Intergenic
972052694 4:34759039-34759061 CAATGTGAAGAGAATTACTGTGG + Intergenic
972440795 4:39089476-39089498 CAAAGGCAAGAGAATGACACTGG + Intronic
972717618 4:41663504-41663526 CAGTGGCATCAGAATTACCATGG - Intronic
973010739 4:45069688-45069710 CAATGGCCTGAGCTTTACCTTGG - Intergenic
974045223 4:56892816-56892838 CACTGGCAAGAGATTGTCCTGGG + Intergenic
974754285 4:66183516-66183538 CAGTGGCAAGGCAATTATCTGGG + Intergenic
975361324 4:73475232-73475254 CAATGGCATGAGCTGTACCTTGG + Intergenic
975914878 4:79312550-79312572 CTGAGGCAGGAGAATTACCTGGG + Intronic
976645301 4:87381332-87381354 CAAGGTCATCAGAATTACCTGGG - Intronic
977350273 4:95875658-95875680 CAAAGACAAGAGAATAACATAGG + Intergenic
978830113 4:113073625-113073647 CCATGGCAAGAAAATCTCCTAGG + Intronic
980150163 4:129036724-129036746 CAAAGGCAAGACAATTCCGTGGG + Intronic
981054187 4:140343195-140343217 CAATGACCAGAGCATGACCTGGG - Intronic
981127244 4:141120787-141120809 CAATGGCAAGAACTTTAACTTGG + Intronic
981713428 4:147731494-147731516 CAATGGCAAGAGCGTTTTCTTGG - Intergenic
982914011 4:161181813-161181835 CTTTGTCAAAAGAATTACCTGGG - Intergenic
983519771 4:168695973-168695995 CACTGGAAGAAGAATTACCTGGG + Intronic
985878277 5:2617671-2617693 CAAATGCAAGAGACATACCTGGG - Intergenic
988103147 5:26708238-26708260 CAATGGCCCGAGATTTACCTTGG - Intergenic
988830601 5:34983352-34983374 CAATGGAAGGAGAATTGTCTTGG - Intergenic
988931084 5:36036069-36036091 CAAAGCCAACAGAATTTCCTTGG - Intronic
991061029 5:62376259-62376281 TCATGGCAAGATAATTCCCTGGG - Intronic
992140385 5:73790784-73790806 CAATGGCCAGAGAATTAAAATGG - Intronic
993416131 5:87634855-87634877 CAATGGCATAAAAATTACCTAGG + Intergenic
994478296 5:100299048-100299070 CAATTGCAAGAGAATGAGCTTGG + Intergenic
994540004 5:101082618-101082640 CAATGGAAGGAGAAGTGCCTGGG + Intergenic
995504682 5:112847802-112847824 GAATGGCAGGAAAATGACCTGGG - Intronic
996104122 5:119478918-119478940 CAATTGCAAGAGAATTTGCAAGG - Exonic
996459056 5:123720135-123720157 CAATGGGAAGAGGATGAACTGGG + Intergenic
996616494 5:125447790-125447812 CAAAGGCAAGAGAAACAACTAGG - Intergenic
997109568 5:131059948-131059970 AAAAGGCAAAAGAATTATCTAGG + Intergenic
998507097 5:142680858-142680880 CAAAGGCAACAGAATTACCTAGG + Intronic
998659187 5:144217079-144217101 CCAAGTCAAGAGAATTCCCTTGG - Intronic
1003490271 6:6615166-6615188 GCAAGGCAAGAGAATCACCTGGG + Intronic
1004636446 6:17472613-17472635 CAATGGCAAGAGAATTACCTTGG + Intronic
1004671142 6:17797999-17798021 TAATGGAAAGAAAATTAGCTTGG - Intronic
1005900143 6:30210296-30210318 TAATGGCCAGAGAATTAGGTAGG - Intronic
1006050255 6:31336719-31336741 CAAGGGCAACAGTATTTCCTTGG - Intronic
1006232916 6:32600489-32600511 CTGAGGCAGGAGAATTACCTGGG + Intergenic
1006746420 6:36345995-36346017 CAATGGAAAGAGAAGTAGATGGG - Intergenic
1007158395 6:39768867-39768889 CAACGGCAACATCATTACCTTGG + Intergenic
1008008593 6:46438825-46438847 CAATGCCAAGAGCAATACTTGGG + Intronic
1008324865 6:50165992-50166014 CAATGTCAAGATTATTGCCTAGG + Intergenic
1009550754 6:65088908-65088930 CAATGTCACGAGATGTACCTTGG - Intronic
1010539154 6:77069747-77069769 CAATGGCAAGAGCTATACCTTGG + Intergenic
1011024988 6:82858431-82858453 CAATAGCAAGAGATCCACCTGGG - Intergenic
1011108874 6:83814092-83814114 CAATAGCAAGAGAAAGCCCTTGG + Intergenic
1012027513 6:94015907-94015929 CAATGCCAATAAAATTACCTTGG - Intergenic
1013172798 6:107652377-107652399 AAATAGCAAGAGAATTACAAGGG + Intronic
1014525902 6:122501543-122501565 CAATGGCTCGAGCATTACTTTGG + Intronic
1017548359 6:155476619-155476641 CAATGGCAATAAAATTTCCGAGG + Intergenic
1017973225 6:159330991-159331013 AAATGGCAGAAGAATTCCCTTGG - Intergenic
1018203870 6:161418613-161418635 GAAAGGCAAGGCAATTACCTCGG + Intronic
1018334375 6:162770231-162770253 CAATTGAAATAGAATTATCTTGG - Intronic
1018925461 6:168202916-168202938 CAATAGCTAGAGAAATACTTAGG - Intergenic
1021445742 7:20731752-20731774 CAATGGCAAGAGAAGCAACAGGG - Intronic
1023117776 7:36879095-36879117 CAAGGGCAAGTTACTTACCTAGG - Intronic
1023426962 7:40047291-40047313 CAATTACAAGAGAATTATCAGGG - Intronic
1024083990 7:45878557-45878579 CAATGGCCTGAGCAGTACCTTGG + Intergenic
1029903399 7:104066318-104066340 CTAAGGCAGGAGAATTGCCTGGG + Intergenic
1031112199 7:117624525-117624547 CTATGGCATGAGTATTTCCTGGG + Intronic
1033352918 7:140576850-140576872 CAATGGTAGGAGCATTTCCTTGG - Intronic
1033499844 7:141936724-141936746 CAATGGCACAAGCATTCCCTTGG - Intronic
1037553152 8:19994442-19994464 CAATGACAAGGGAAGTGCCTGGG + Intergenic
1038507435 8:28096879-28096901 TAAAGGGAAGAGAATTACTTTGG + Intronic
1040521497 8:48180031-48180053 CAATGAACAGAGAATTAGCTAGG + Intergenic
1045700301 8:104858661-104858683 CAATGGTAGGGGAATTACTTAGG + Intronic
1046094964 8:109546687-109546709 CACTGGAAAAAGAATTATCTTGG - Intronic
1046903075 8:119543561-119543583 CATTGGAAGAAGAATTACCTTGG - Intergenic
1047145809 8:122198020-122198042 CATGAACAAGAGAATTACCTGGG + Intergenic
1047456138 8:125013826-125013848 CAAGGGCAAGAAAATTCACTGGG - Intronic
1047654714 8:126964590-126964612 AAATGTCAAGGGAATTATCTTGG - Intergenic
1048418346 8:134251653-134251675 CAAAGGCAAGAGAATTTATTTGG - Intergenic
1048809041 8:138268538-138268560 CAATCGCAAGACACTTCCCTGGG + Intronic
1049489648 8:142888542-142888564 CAATGGCCTGAGATGTACCTTGG + Intronic
1050022364 9:1297594-1297616 CAATTTCAAGACAATTTCCTTGG - Intergenic
1050818095 9:9840600-9840622 AAATGGGAAGGGAATTAGCTGGG + Intronic
1050821737 9:9888002-9888024 GAAGGGCAAGACAATGACCTGGG + Intronic
1051888561 9:21920344-21920366 CAATGAAAAGAGATTTTCCTTGG + Intronic
1052534718 9:29732254-29732276 CAATGGCCAGAGAAGCCCCTGGG - Intergenic
1053310637 9:37016651-37016673 CAACTGCAAGATAATTTCCTTGG - Intronic
1055002436 9:71467280-71467302 CAATGACTAGAGAAACACCTAGG - Intergenic
1058191186 9:101917989-101918011 CAATGGAACTAGAAATACCTTGG - Intergenic
1058915673 9:109561969-109561991 GGATGGAAAGAGAAATACCTGGG - Intergenic
1059643292 9:116238249-116238271 CAATGGCATCAGTATCACCTGGG + Intronic
1059919818 9:119147155-119147177 CAATGTCAAGAGGATTTGCTAGG + Intergenic
1185889374 X:3810749-3810771 CAATGGCAAGATAATGTCCTGGG - Intergenic
1186459868 X:9739681-9739703 CAAAGACAAGAGAAATCCCTGGG + Exonic
1186656335 X:11615832-11615854 CAATGGGAAAAGTATTATCTAGG - Intronic
1186860816 X:13670718-13670740 CAATGGCATCAGCATCACCTGGG + Intronic
1188592838 X:31860295-31860317 CAAAAGCAAGAGAATGATCTAGG + Intronic
1189815767 X:44822959-44822981 CAATGGCCAGAGCTGTACCTTGG - Intergenic
1189825737 X:44915094-44915116 TAATGGCAAGAAAAAAACCTTGG - Intronic
1190437778 X:50443632-50443654 CAAAAGCAAGAGAATGACATTGG + Intronic
1192119057 X:68437784-68437806 CCAAGGCAGGAGAATTGCCTTGG - Intergenic
1192384431 X:70651845-70651867 AAATAGCAAAAGAATTACCAAGG + Intronic
1193203271 X:78717373-78717395 AAATGGCAAGATAATTACAGTGG + Intergenic
1193235411 X:79100696-79100718 CAATAGGAAGAGATTTACATAGG - Intergenic
1193865816 X:86728714-86728736 TAGTGGCAAGAGCATTATCTGGG - Intronic
1194212038 X:91081887-91081909 CAATGGCCTGAGATGTACCTGGG + Intergenic
1194944175 X:100048537-100048559 CAATGGCCAGAGCTATACCTTGG - Intergenic
1197058912 X:122153783-122153805 CAATGGCCAGAGCTGTACCTTGG - Intergenic
1197332266 X:125168374-125168396 CAATGACAATACAAGTACCTTGG - Intergenic
1198237469 X:134748762-134748784 GACTGGCAAGACAATTACCTAGG + Intronic
1198956237 X:142134821-142134843 CAATGGCCAGAGCAGTACCTTGG - Intergenic
1199091790 X:143701735-143701757 CAGTGGCCTGAGAAGTACCTGGG - Intergenic