ID: 1004637730

View in Genome Browser
Species Human (GRCh38)
Location 6:17485190-17485212
Sequence TTTTATGTGAATATTTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1018
Summary {0: 1, 1: 0, 2: 3, 3: 100, 4: 914}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004637725_1004637730 29 Left 1004637725 6:17485138-17485160 CCAGTCCTGGGTTTTTTTTTTCT 0: 1
1: 2
2: 29
3: 501
4: 4733
Right 1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG 0: 1
1: 0
2: 3
3: 100
4: 914
1004637724_1004637730 30 Left 1004637724 6:17485137-17485159 CCCAGTCCTGGGTTTTTTTTTTC 0: 1
1: 0
2: 13
3: 183
4: 1614
Right 1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG 0: 1
1: 0
2: 3
3: 100
4: 914
1004637727_1004637730 2 Left 1004637727 6:17485165-17485187 CCTGTTATAAACAGTACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG 0: 1
1: 0
2: 3
3: 100
4: 914
1004637726_1004637730 24 Left 1004637726 6:17485143-17485165 CCTGGGTTTTTTTTTTCTCAGTC 0: 1
1: 0
2: 2
3: 81
4: 936
Right 1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG 0: 1
1: 0
2: 3
3: 100
4: 914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004637730 Original CRISPR TTTTATGTGAATATTTATGA GGG Intronic
900944728 1:5823549-5823571 TTTTATGTTAATTTTTGAGATGG - Intergenic
901276700 1:7997052-7997074 TTCTATATAAATATTTCTGAAGG + Intergenic
902593370 1:17490975-17490997 TTTTATGTGAACAGTTTTGGGGG - Intergenic
903313801 1:22483907-22483929 TTTTAAGTTAATTTTTGTGAAGG + Intronic
903688575 1:25152029-25152051 TTTTAAGGCAATAATTATGATGG + Intergenic
904845602 1:33411911-33411933 TTTGTTGTGAATTGTTATGATGG - Intronic
904928564 1:34067720-34067742 TTTTATGTGAATCTTCATAGGGG - Intronic
904967494 1:34388182-34388204 TTTTGTGTCTATATTCATGAGGG + Intergenic
905474061 1:38213522-38213544 GTTTATGTAAATATTTAATAGGG - Intergenic
906784738 1:48604903-48604925 TTTTATGTAGATATGGATGAAGG - Intronic
907029420 1:51156013-51156035 TGTTATGTGAATATGTATAAGGG + Intergenic
908145250 1:61234567-61234589 TTATATGCTAGTATTTATGAAGG - Intronic
908590030 1:65621219-65621241 TTTTATTTTTATATTTTTGAAGG + Intronic
909001132 1:70218887-70218909 TATTTTTTGAATATTTTTGATGG - Intronic
909167468 1:72247214-72247236 GGTTATGTGAATATCTCTGAAGG + Intronic
909412254 1:75368058-75368080 TTTTTTGTCAATATTTATTGAGG + Intronic
909506845 1:76401492-76401514 TTTTATGTGAGTATTTTTGTTGG + Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
910285999 1:85554943-85554965 TGTTATTTAAATATTTAAGAGGG + Intronic
910570860 1:88700913-88700935 TTTTATTTTGGTATTTATGAGGG + Intronic
910796365 1:91101627-91101649 GTTGTTGTGAATATTTATAATGG - Intergenic
910797997 1:91117839-91117861 TTTTATGTTAAGTTTGATGAAGG - Intergenic
911489209 1:98541455-98541477 TTTGAAATGAATATTTATGCCGG + Intergenic
911626076 1:100125965-100125987 TTTCGTGTGAATGTTTCTGATGG - Intronic
912009526 1:104941514-104941536 TTGTATATGTATATATATGAAGG + Intergenic
913127235 1:115803819-115803841 TTCTATATGAGTAGTTATGAAGG + Intergenic
913427009 1:118743969-118743991 TTTTTTGTAAATATTTTTAATGG - Intergenic
913581865 1:120234287-120234309 TATAATGTGAATATTAAAGAAGG + Intergenic
913613105 1:120527970-120527992 TTTTATGTGAAGTTTTGTAATGG - Intergenic
913626310 1:120664102-120664124 TATAATGTGAATATTAAAGAAGG - Intergenic
914230153 1:145758480-145758502 TATTATCTCAATATTTTTGAGGG - Intronic
914371459 1:147028727-147028749 TTTTATGTGAACTTTTGTAATGG - Intergenic
914563796 1:148845734-148845756 TATAATGTGAATATTAAAGAAGG + Intronic
914578081 1:148994277-148994299 TTTTATGTGAAGTTTTGTAATGG + Intronic
914609031 1:149284492-149284514 TATAATGTGAATATTAAAGAAGG - Intergenic
914727930 1:150343925-150343947 CATTATCTGAAAATTTATGAAGG - Intronic
915015956 1:152733858-152733880 CCATATGTGAATATTTATGAAGG - Intergenic
915663888 1:157427121-157427143 TTTTACTTGAACATCTATGAGGG + Intergenic
916040546 1:160957508-160957530 TTTTATTTGAGTATTTATATAGG + Intergenic
916573743 1:166049445-166049467 TAATAAATGAATATTTATGAGGG + Intergenic
916692045 1:167199488-167199510 TTTTATTTGAATAGTCATGTAGG - Intergenic
916790214 1:168118594-168118616 TTTTATGTGTATATATTTAAGGG - Intronic
916902329 1:169241905-169241927 TTTTATATTTATATTTATAAGGG - Intronic
917897991 1:179511251-179511273 TTATATATGTATATATATGATGG - Intronic
917907890 1:179606593-179606615 TTTTAAGTTAATGTTTGTGAAGG + Intronic
918266996 1:182852471-182852493 TAATATGTGCAAATTTATGAAGG - Intronic
918292165 1:183119336-183119358 TTTTATCTGGATATTCATGCAGG - Intronic
918391317 1:184066138-184066160 TTTTTAGTTAATTTTTATGAAGG + Intronic
918453153 1:184680426-184680448 TTTTCTGTTAATATTCATGTGGG - Intergenic
918550588 1:185737551-185737573 TTCTATGTGAATATCTCTTAAGG + Intronic
918868013 1:189928628-189928650 TTTCAAGTTAATATTTGTGAAGG + Intergenic
918976980 1:191502294-191502316 TTTTGAGTGTATATTTAGGAAGG - Intergenic
919248918 1:195028090-195028112 TTTTATGTGAATTTTCTTAAAGG + Intergenic
919717030 1:200789336-200789358 TTTTGAGTTAATTTTTATGAAGG + Intronic
920005343 1:202829138-202829160 TTTTATGTTAATTATTTTGAGGG - Intergenic
920318116 1:205094602-205094624 TATTATGTGAATATTTTTCTGGG - Intronic
920550025 1:206852052-206852074 TTTTTTGGGGATTTTTATGAAGG - Intergenic
920578966 1:207086700-207086722 TTTTATGTCCATATTTATGTAGG + Intronic
920731760 1:208493350-208493372 TTTTGTGTCTATATTTATCAGGG + Intergenic
921625161 1:217371722-217371744 TTTTATTTAAAGCTTTATGATGG - Intergenic
921711095 1:218374015-218374037 TCTTATGTGAATCTATATGGAGG + Intronic
922201603 1:223406906-223406928 TTTTATGTTTATATTCATGAAGG - Intergenic
922386736 1:225093215-225093237 TTTTATGTGCATGTTTGTCAAGG - Intronic
922624230 1:227021620-227021642 TTTTCTGTGATTATTTTTGTTGG - Intronic
923264248 1:232298314-232298336 TTTTATGTGGATATTTAATAAGG - Intergenic
923642597 1:235779925-235779947 TTTTCTAAGACTATTTATGAAGG + Intronic
923818611 1:237408347-237408369 TTTTGAGTTAATTTTTATGAAGG + Intronic
924551576 1:245083017-245083039 TTTTATGTGGTCATTTATTACGG + Intronic
924608283 1:245553526-245553548 TTATATATGAATATTTTTTATGG + Intronic
1063028685 10:2209447-2209469 TGTTAAGTTAATATTTATAAAGG - Intergenic
1063267310 10:4467687-4467709 ATTTAAGTGATTATTTTTGAAGG - Intergenic
1064128940 10:12690476-12690498 AAATCTGTGAATATTTATGAGGG + Intronic
1064202563 10:13297343-13297365 TTGTATGAGAATATTTAGGAAGG + Intronic
1064263462 10:13805046-13805068 TTGTATGTAAACTTTTATGAAGG + Intronic
1064595248 10:16937774-16937796 TTTTATGTACAGATCTATGATGG - Exonic
1064609647 10:17085006-17085028 TTTTCTGAGAACATTTATTAAGG + Intronic
1064768740 10:18701580-18701602 TTCTATGTGATTAATCATGAAGG + Intergenic
1065221979 10:23505471-23505493 TTTTATGTGTTTATTTATTTGGG + Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067386201 10:45819499-45819521 TTTGATGTGTATGTTGATGATGG - Intergenic
1067448072 10:46365063-46365085 TTTGATGTGTGTATTGATGATGG + Intergenic
1067589308 10:47495698-47495720 TTTGATGTGTGTATTGATGATGG - Intergenic
1067636432 10:48003777-48003799 TTTGATGTGTGTATTGATGATGG - Intergenic
1067759479 10:49033063-49033085 CTTTATGTGAGTATTTCTGTAGG - Intronic
1068171569 10:53401636-53401658 TGTTATGGGAATACTTATGTTGG - Intergenic
1068282219 10:54888542-54888564 TTTTAGGTAAATACTTAGGATGG + Intronic
1068348869 10:55818017-55818039 TATTATGTGACTACTTAAGAAGG - Intergenic
1068352398 10:55865107-55865129 AATTATATGGATATTTATGAAGG - Intergenic
1069272629 10:66548850-66548872 TTTTTTGCTAATATTTATTAAGG + Intronic
1069586764 10:69611008-69611030 TTTTGAGTTAATTTTTATGAAGG - Intergenic
1070095231 10:73331143-73331165 TCTTATATAAATATTTTTGAGGG + Intronic
1070402329 10:76064222-76064244 TTTCCTGGGATTATTTATGATGG + Intronic
1071323009 10:84483454-84483476 TATTTTATAAATATTTATGATGG - Intronic
1071332963 10:84579078-84579100 ATATATGTGTATATATATGAGGG + Intergenic
1072184446 10:93021862-93021884 TTGTATATGAATTTTTATGGTGG + Intronic
1072206674 10:93210947-93210969 TCTTATGGGAATACTTATGGTGG - Intergenic
1072553329 10:96495345-96495367 TTTTCTGTGAATCTTTGTCAAGG + Intronic
1072716984 10:97758964-97758986 TTTTATTTAAAAATTTTTGAAGG + Intronic
1072743244 10:97922822-97922844 TATTCCGTAAATATTTATGAAGG + Intronic
1072776659 10:98203215-98203237 TTTTTCCTGAATATTTTTGAGGG - Intronic
1073335206 10:102702275-102702297 TTTTCTATGCATATATATGATGG - Intronic
1074612186 10:115032792-115032814 TTTTATGTGACTATTTTAAATGG + Intergenic
1074989944 10:118696118-118696140 TTATGTTTGAATATATATGATGG + Intronic
1076012446 10:127001162-127001184 ATTCATATGGATATTTATGAGGG + Intronic
1076226569 10:128781183-128781205 TCTTAAATGAATATTTATTAAGG + Intergenic
1076332419 10:129680198-129680220 TTTTCTGTGAATTTTCATTAAGG + Intronic
1076605649 10:131688101-131688123 TTTTGTGTGCATATTTGTGCAGG - Intergenic
1077876487 11:6312838-6312860 TTTTATGTGTAAAGTTGTGATGG - Intergenic
1077923471 11:6657951-6657973 ATTGAGCTGAATATTTATGATGG + Intergenic
1077974717 11:7235915-7235937 ATTTTTGTGAATCTTGATGAAGG - Intergenic
1078167806 11:8904149-8904171 TTTTCTGTGTATATTCATGAGGG - Intronic
1078297669 11:10090452-10090474 TTTTATGTGCTTATTTTTCACGG - Intronic
1078403824 11:11050589-11050611 TTTTATGTCTTTATTTATGGGGG + Intergenic
1078894566 11:15586588-15586610 TTTTCAGTGAACATTTCTGAGGG - Intergenic
1079513754 11:21242028-21242050 TTGTCTGTGAATAGATATGATGG + Intronic
1079763725 11:24362812-24362834 ATTTCTGTGAGTATTTTTGAGGG - Intergenic
1080010805 11:27457703-27457725 CTCTGTGTGAATATTTATGGTGG + Intronic
1080032054 11:27672026-27672048 TTTTATGGGGACATTTATGTGGG + Intronic
1080147888 11:29009672-29009694 TTTAATTTGCATATTTCTGATGG + Intergenic
1080880119 11:36311962-36311984 TTTCATGTGAATATTCAGGGGGG - Intronic
1081001237 11:37675201-37675223 CTTTATGTGGATATATATGGAGG - Intergenic
1081066675 11:38550054-38550076 TCTTATGTGATTTTTTGTGATGG + Intergenic
1081214462 11:40378320-40378342 TTTTCTGTGATTATTCCTGAAGG - Intronic
1081369486 11:42282318-42282340 CATTATGTTAATATATATGATGG + Intergenic
1082189662 11:49227517-49227539 TAGTATCTGAATATTGATGATGG + Intergenic
1082213982 11:49544732-49544754 TTTTCTTTGAATTTTTATGGGGG + Intergenic
1083122164 11:60524446-60524468 TTTTATCTGTAAAATTATGAGGG - Intronic
1085157314 11:74307726-74307748 TTTTATGTGCAGATTCTTGAAGG - Intronic
1085975692 11:81651109-81651131 TTTTGTGTCTATCTTTATGAGGG - Intergenic
1086306973 11:85490993-85491015 TTTTATGTATATATTCATCAGGG - Intronic
1086418075 11:86609303-86609325 TTTTCACTGAATATTCATGATGG - Intronic
1086635620 11:89079757-89079779 TTTTCTTTGAATTTTTATGGGGG - Intergenic
1086676864 11:89618983-89619005 TAGTATCTGAATATTGATGATGG - Intergenic
1087549425 11:99629057-99629079 TTTTCTGTGAGTATTTAGTAAGG - Intronic
1087571663 11:99935044-99935066 TTCTATGTGAAGATATATGCTGG - Intronic
1087675918 11:101161305-101161327 TTTGATGAGAATTTTTATAAAGG + Intergenic
1087997419 11:104826760-104826782 TTTTATGCTAATTTTTATAAAGG + Intergenic
1087998029 11:104836145-104836167 TTTTAAGTAAATATTTGTTAAGG + Intergenic
1088128163 11:106453542-106453564 TTTAATGTGATTATTGATAATGG + Intergenic
1088209245 11:107435533-107435555 CTCTATGTTAACATTTATGAAGG + Intronic
1089162102 11:116446249-116446271 ATTTGTGTCAATATTTATAAAGG - Intergenic
1089463934 11:118671208-118671230 TTTTATGTGAAAATTCCTAAGGG - Intronic
1089822765 11:121243451-121243473 TATTATGTTTATATTTATTAAGG + Intergenic
1089871606 11:121678254-121678276 TTTTGTGTTTATATTTATGAAGG + Intergenic
1090127768 11:124106177-124106199 TTTTGTGTCTATATTCATGAAGG - Intergenic
1090847183 11:130539923-130539945 TTTTGTGTGGATATTCATCAGGG + Intergenic
1091211840 11:133867516-133867538 TTTTGTATCAATATTTATCAGGG + Intergenic
1091619985 12:2079754-2079776 GTTTTTGTGATTATTTTTGAAGG - Intronic
1093001566 12:14002359-14002381 ATATATGTGTATATATATGATGG - Intergenic
1093012289 12:14120969-14120991 TTTTATGTCTATATTCATGAGGG - Intergenic
1093061053 12:14604875-14604897 TTTTATTTGCATAATTATGTTGG + Intergenic
1093081253 12:14814197-14814219 TTTCATCTGGATATTTCTGATGG + Intronic
1093332876 12:17864455-17864477 TTTAAGATGAATATTTCTGAAGG - Intergenic
1093350697 12:18099335-18099357 TTTTATGTGATTAGTTTTGATGG + Intronic
1093563467 12:20572637-20572659 TTTCATGCTAAAATTTATGAAGG + Intronic
1093823827 12:23656764-23656786 TTTTATATAAATATATATAATGG + Intronic
1093897306 12:24588800-24588822 ATTTTTCTGAATATTTAGGATGG + Intergenic
1094457114 12:30647901-30647923 TTTTATTTGCATTTTTATGATGG - Intronic
1094633953 12:32205577-32205599 TTTTATGTCAAATTTTATAATGG + Intronic
1095125926 12:38477185-38477207 TTTTATTTGAAAAGTCATGATGG - Intergenic
1095511919 12:42960377-42960399 TTTTGTGGGAATATTTATACTGG + Intergenic
1095583088 12:43822143-43822165 TTTTATGTGTATTTTTACTAAGG + Intergenic
1096039880 12:48505532-48505554 TTTTAGGTTAATTTTTGTGAAGG - Intergenic
1096341224 12:50801539-50801561 TTTTGTGTCTATATTCATGAAGG - Intronic
1096361662 12:50993178-50993200 TTTTTTTTTAATATTTAAGATGG - Intronic
1096953861 12:55505419-55505441 TTTTATTTGAATTTCTCTGATGG + Intergenic
1097652161 12:62312839-62312861 TTTTATGTAAACAAATATGAAGG + Intronic
1097659370 12:62412077-62412099 CTTTATTTAAATATTTATGGTGG - Intronic
1097841006 12:64321250-64321272 TTTTATTTCAATAATTTTGAGGG + Intronic
1097930708 12:65182002-65182024 TTTTATTTTAATTTTCATGAGGG + Intronic
1099139853 12:78958908-78958930 TATTATAAGAATATTTATGTAGG - Intronic
1099221149 12:79916294-79916316 TTTTGTGAAAATATTTTTGAAGG - Intronic
1099783739 12:87234436-87234458 TACTATTTGAATATTTATGATGG - Intergenic
1099852888 12:88125399-88125421 TTTTAGGTTAATATTCATGAAGG - Intronic
1099857558 12:88185950-88185972 TTTTACATCTATATTTATGAAGG + Intronic
1100033013 12:90215911-90215933 TTTTTTATGAATATTTGTAAAGG - Intergenic
1101121187 12:101581972-101581994 TTTTATGTGCTTATTTCTTATGG + Intronic
1101400225 12:104380755-104380777 TTTCATGTATATATTCATGAGGG + Intergenic
1101459925 12:104880736-104880758 TTTTGTGTCAATGTTTATCAGGG + Intronic
1102358472 12:112261319-112261341 TGCTATGTCACTATTTATGAGGG + Exonic
1103828600 12:123761555-123761577 TTTGATGGGAATATCTAAGAAGG + Exonic
1104296159 12:127515811-127515833 TATTATGATAATATTGATGAGGG - Intergenic
1105655504 13:22433195-22433217 TTTTATGTATATATATATAATGG + Intergenic
1105872859 13:24523115-24523137 TTGTGTCAGAATATTTATGATGG - Intergenic
1105979992 13:25509283-25509305 TGTCATGTAAATTTTTATGATGG - Intronic
1106146175 13:27051969-27051991 ATATATGTGTATATATATGATGG + Intergenic
1106381815 13:29246505-29246527 TTTTGTGTGCTTATTAATGAAGG + Intronic
1106608901 13:31259313-31259335 TTTTATGTGAAAAATTAAGAAGG + Intronic
1106764389 13:32899346-32899368 TTTTCTGAGAATAATTGTGAGGG - Intergenic
1107198082 13:37678803-37678825 ATTTTTGTGCATATTTATAAGGG - Intronic
1107527215 13:41244875-41244897 TTTTATCTCACAATTTATGAGGG - Intronic
1107750064 13:43555596-43555618 TTTGATGTGATGATTTATTAAGG - Intronic
1108012379 13:46031276-46031298 TTTTAAGTTAATTTTTGTGAAGG - Intronic
1108905789 13:55470758-55470780 TTTTATATTTATATTCATGAAGG + Intergenic
1108987409 13:56610415-56610437 TTGAATGTACATATTTATGAAGG - Intergenic
1109064028 13:57660896-57660918 TTATGTATGAATATGTATGATGG + Intronic
1109119075 13:58430549-58430571 TGCTATCTGAATTTTTATGATGG + Intergenic
1109308782 13:60668187-60668209 TTTTGTGTCTATATTTATTAGGG + Intergenic
1109386624 13:61637248-61637270 TTTTTGTTAAATATTTATGAAGG + Intergenic
1109416045 13:62042382-62042404 ATTGATGTGAATAATAATGAAGG - Intergenic
1109435770 13:62299558-62299580 TCTTATGCAAATATTTGTGAAGG - Intergenic
1109555221 13:63965422-63965444 TATTATGTGAAGAATTTTGAGGG + Intergenic
1109595427 13:64547685-64547707 TTATATATAAGTATTTATGAAGG + Intergenic
1109729231 13:66388916-66388938 TTTAAGCTGAATATTTATGTTGG - Intronic
1109811794 13:67522522-67522544 TTATATGTAAATATTTATTAAGG - Intergenic
1109867806 13:68288446-68288468 TTTTATTTTTATATTCATGAAGG + Intergenic
1109988620 13:70023367-70023389 TTTTAGGTGAAGTGTTATGATGG - Intronic
1110254421 13:73417063-73417085 TTTTATATAAAGTTTTATGATGG + Intergenic
1110538011 13:76674807-76674829 ATATATGTGTATATATATGATGG + Intergenic
1110670827 13:78175442-78175464 TTTTATGTGTTTATTTATTAAGG - Intergenic
1110804585 13:79739361-79739383 ACTTATGTGTATTTTTATGATGG + Intergenic
1110887942 13:80661683-80661705 TTTTATATCTATATTTATCAAGG + Intergenic
1110918660 13:81056767-81056789 TTTTATGTTAAGTTTGATGAAGG + Intergenic
1110963111 13:81656406-81656428 TTTTATGTCTATATTTATCGGGG + Intergenic
1110980845 13:81895716-81895738 TTATAAGTGACTATATATGATGG - Intergenic
1111018234 13:82409095-82409117 TTTCTTATGAATTTTTATGAAGG - Intergenic
1111032983 13:82632050-82632072 TCTTATGAGGATATTTATGATGG + Intergenic
1111121852 13:83862611-83862633 TTTTTTTTTAATATTAATGAAGG - Intergenic
1111275835 13:85945830-85945852 TTCTATGTGAATATTCAATAGGG - Intergenic
1111501067 13:89120416-89120438 TTTTAAAGGAAAATTTATGAGGG + Intergenic
1111534483 13:89584627-89584649 TTATATGTGTATATTGGTGAGGG - Intergenic
1111547633 13:89763480-89763502 TTTTGTGTGTATTTTTATCAGGG - Intergenic
1111565566 13:90010299-90010321 TTTTATCTCAATATTTTAGAAGG - Intergenic
1111897842 13:94163180-94163202 TTTTTTGTTAATTTTTATTATGG + Intronic
1112336062 13:98517169-98517191 TTTAATATGAATTATTATGATGG - Intronic
1113069218 13:106403572-106403594 AGTTATGTGAATGTTTATGTTGG - Intergenic
1113168438 13:107470554-107470576 ATTTGTGTGACTATTTCTGAAGG - Intronic
1113249273 13:108433519-108433541 TTTTATGTTAATATTGTTTATGG + Intergenic
1113268282 13:108643749-108643771 TTGTCTTTGAATATTTATAAAGG - Intronic
1113817136 13:113180283-113180305 CTTGATATGAATATTTATCAAGG - Intronic
1114287966 14:21263199-21263221 TATTATATTAATACTTATGATGG - Intronic
1114740413 14:25091103-25091125 TTTTATGTGATTATTGCTGGTGG + Intergenic
1114749772 14:25190171-25190193 TCTTACATGATTATTTATGAAGG + Intergenic
1115056093 14:29128931-29128953 TTTTAGGTCAATATCTGTGATGG - Intergenic
1115125822 14:29992535-29992557 TTTTGTGGCTATATTTATGAGGG + Intronic
1115125868 14:29993208-29993230 ATATATGAGGATATTTATGATGG + Intronic
1115457420 14:33619881-33619903 TTTTCTGTGGTGATTTATGATGG + Intronic
1115962100 14:38846596-38846618 TTTTATTTGCATAATTATGCAGG + Intergenic
1116317265 14:43414051-43414073 TTCTATGAGCATATTTATTATGG - Intergenic
1116484741 14:45434093-45434115 TCTTACATGATTATTTATGAAGG + Intergenic
1116625960 14:47263735-47263757 TTATAAGTGAATATTTGTCAAGG - Intronic
1116878923 14:50144138-50144160 TTTTCTGTGATAATTTATCATGG - Intronic
1117022450 14:51585290-51585312 TCGTATGTGTATATGTATGAAGG - Intronic
1117184142 14:53222839-53222861 TTTTATGTTTATATTCATCAGGG + Intergenic
1117216291 14:53556008-53556030 TTTTATGTAATTTTTTAGGAAGG + Intergenic
1117697514 14:58380921-58380943 CTATATATGAATATTTATGCTGG - Intergenic
1117845666 14:59908807-59908829 ATATATGTGTATATATATGATGG - Intergenic
1118069389 14:62229426-62229448 TTTTACATGTATGTTTATGAGGG + Intergenic
1118413754 14:65510348-65510370 TTTTGTATGAATATTCATCAGGG + Intronic
1118583057 14:67324355-67324377 TTTTATTTAAATATGTAAGATGG + Intronic
1118732940 14:68682039-68682061 TTTAATGTTAATATTTTTGGGGG - Intronic
1118911083 14:70062765-70062787 TTTTTTGGGAATATTTCTGTTGG + Intronic
1119075870 14:71638263-71638285 TTTTACATGTATATTCATGAGGG - Intronic
1119284596 14:73442451-73442473 TTTTATGTGAATGTTCATATTGG + Intronic
1119915289 14:78394493-78394515 TTTTGTGTCTATATTTATAAAGG + Intronic
1120630536 14:86884438-86884460 GTGTATGTGAGTATGTATGAAGG - Intergenic
1121621790 14:95355203-95355225 TTTTATTTGTATATTTTTGGGGG - Intergenic
1121958080 14:98232452-98232474 TTTTATTTGTATTTTTCTGATGG - Intergenic
1121997934 14:98619612-98619634 TTTTATTTGTATTTCTATGATGG - Intergenic
1122085895 14:99304501-99304523 TTTTATGTCTATTTTTGTGAGGG - Intergenic
1122761020 14:104026565-104026587 TTTTATGAGAATATTATTGAAGG + Intronic
1122815664 14:104310970-104310992 TTTTATGTCTGTATTCATGAGGG - Intergenic
1123133166 14:106004546-106004568 TTAAATGTGAATTTTTATTACGG + Intergenic
1123832727 15:24158265-24158287 TTTTTTATAGATATTTATGAAGG - Intergenic
1123849322 15:24338957-24338979 TTTTTTATAGATATTTATGAAGG - Intergenic
1123852514 15:24374910-24374932 TTTTTTATAGATATTTATGAAGG - Intergenic
1123868381 15:24546465-24546487 TTTTTTATAGATATTTATGAAGG - Intergenic
1124703153 15:31935119-31935141 TTTTTTGTTTATATATATGAAGG - Intergenic
1124984863 15:34597750-34597772 TTTTATTTTATTTTTTATGACGG + Intergenic
1125071103 15:35554068-35554090 TTTAATGTGATTATTGATGTTGG - Intergenic
1125455055 15:39849494-39849516 TTTTGTGTAACTATTCATGAGGG - Intronic
1125561968 15:40641044-40641066 TTTTATGTGTGTTTTTTTGAGGG + Intronic
1125562419 15:40646003-40646025 TTTTATTTCAGTATGTATGATGG - Intronic
1125626440 15:41113217-41113239 TTTAATGTGAATTTGTATGTTGG + Intronic
1126037582 15:44560929-44560951 TTTTGTGTGTTTGTTTATGAGGG + Intronic
1126285272 15:47003095-47003117 TTTTGTTTCTATATTTATGAGGG + Intergenic
1126423976 15:48505786-48505808 TTTTATGTGTATACTTAAGGAGG + Intronic
1126429247 15:48563261-48563283 TTTTAGGTAAATATTTTTAATGG + Intronic
1126533777 15:49738374-49738396 TTTTGTGTCGATATTTATCAAGG - Intergenic
1126601143 15:50428715-50428737 TTTTATCTGCAAAATTATGAAGG - Intronic
1126685816 15:51247925-51247947 TTATATGTTAATTTTTATAATGG + Intronic
1126824532 15:52536058-52536080 TTTTATGTGTATTATTATTAAGG + Intergenic
1126834455 15:52645503-52645525 TGCTATGGGAATATTTAGGAGGG + Intronic
1126848748 15:52785208-52785230 TTTTTTGTTAATATTTATCCCGG - Intronic
1128436124 15:67650750-67650772 TTTTGTATTCATATTTATGAGGG + Intronic
1129684709 15:77678613-77678635 CTGTATGTGAATATTTATAGTGG - Intronic
1130178384 15:81599008-81599030 TTTTGAGTTAATTTTTATGAGGG + Intergenic
1131653782 15:94432038-94432060 TTTTGTATGAATACTTAAGAGGG - Intronic
1131699551 15:94919260-94919282 TTTTTAATGAATATTTATTAGGG + Intergenic
1131911209 15:97205088-97205110 TTTTATGTAAAAAATTATAAAGG + Intergenic
1131934029 15:97481834-97481856 TTTTGTGTGTATATGGATGATGG - Intergenic
1131955532 15:97731256-97731278 TTTTATGTGAACATTGTTAAAGG - Intergenic
1132127656 15:99242558-99242580 TTTTGTGTCCATATTCATGAAGG - Intronic
1132435572 15:101798890-101798912 TTTAATGAGAATACATATGAAGG - Intergenic
1133559775 16:6940478-6940500 ATTTAGGTAAATATTGATGAAGG + Intronic
1133655010 16:7852904-7852926 TTCTATGTTTATATTTTTGAGGG + Intergenic
1133668291 16:7992643-7992665 TTTTATGTAAATATTTTTAGAGG - Intergenic
1133969527 16:10557751-10557773 TTTTATGTGATTATTTTTATGGG - Intronic
1134307344 16:13044869-13044891 TTTTATTTGACTTTTTATGATGG - Intronic
1134890297 16:17835681-17835703 TTTTAAGTGGTAATTTATGAAGG - Intergenic
1136487155 16:30580800-30580822 TTGTATGTCAACAGTTATGAAGG - Exonic
1136495435 16:30640528-30640550 TGTTTTGTGAATTTTTAGGAGGG - Intergenic
1137296946 16:47103606-47103628 TTTTATATTAATATTCATAAGGG - Intronic
1137459327 16:48645191-48645213 TTTTGTGTCTATATTTATCAGGG + Intergenic
1138299965 16:55917808-55917830 TTTTATATGTATGTTTAAGATGG - Intronic
1138844901 16:60553988-60554010 CTTTAAGTGAATATTGGTGATGG - Intergenic
1138908928 16:61372878-61372900 TACTTTGTGAATATTTATAATGG + Intergenic
1139059686 16:63233913-63233935 TTTTATGTGTATATTTTTTATGG + Intergenic
1139251901 16:65504781-65504803 TTTTATGTCAATAGTTGTGTGGG + Intergenic
1140023640 16:71263373-71263395 TTCTATGTCAATATTCATAAGGG + Intergenic
1140287982 16:73622606-73622628 TTTTAAGTAAATATTAATGTTGG - Intergenic
1140935604 16:79666919-79666941 ATATATATGAATTTTTATGAGGG - Intergenic
1141060680 16:80865871-80865893 TTTTATATCTATATTTATGAGGG - Intergenic
1142585550 17:970644-970666 TTTGATGTGAGTATTTTTTAAGG + Intronic
1142822654 17:2483635-2483657 TTTTATGTGAAAATTGATTGAGG - Intronic
1143815619 17:9511330-9511352 TTTTGTGTGTATATTTATCAGGG - Intronic
1143925727 17:10367647-10367669 TTTTATTAAAATATTTATGTTGG - Intronic
1144516474 17:15920751-15920773 TTTTATGTGAAAATTTGTGGTGG - Intergenic
1144529391 17:16021493-16021515 TGCTATGTAGATATTTATGAAGG + Intronic
1145820300 17:27828267-27828289 TTTTGTGTCAATATTCATCAGGG - Intronic
1145893761 17:28438861-28438883 TTTTATTTCAATTTTTATTATGG + Intergenic
1146223228 17:31044517-31044539 CTTTATGTAAATATGTATGTAGG + Intergenic
1146341769 17:32025469-32025491 CTTTATGTAAATATGTATGTAGG - Intronic
1146351035 17:32094162-32094184 CTTTATGTAAATATGTATGTAGG + Intergenic
1146905270 17:36613979-36614001 TTGTATGTGAGGATTAATGATGG + Intergenic
1147233224 17:39034920-39034942 CTTTATGTAAATATGTATGTAGG - Intergenic
1148173562 17:45544903-45544925 CTTTATGTAAATATGTATGTAGG + Intergenic
1148275708 17:46300546-46300568 CTTTATGTAAATATGTATGTAGG - Intronic
1148297818 17:46518122-46518144 CTTTATGTAAATATGTATGTAGG - Intronic
1148362368 17:47022603-47022625 CTTTATGTAAATATGTATGTAGG - Intronic
1148963452 17:51413283-51413305 TTTTGTGAGAATAGTTATAATGG + Intergenic
1148976136 17:51530572-51530594 TTTTATTTCAATATTTTTGGGGG - Intergenic
1149069528 17:52522847-52522869 TTTTATTTGAATAGTTATAGTGG - Intergenic
1149798736 17:59546432-59546454 TTATAAGCAAATATTTATGAGGG + Intergenic
1150141355 17:62731835-62731857 TGTTATGTCAATTTTTTTGAGGG - Intronic
1150282461 17:63937357-63937379 TTTTATGTCAATAGTTTTGGGGG - Intergenic
1150404768 17:64891818-64891840 CTTTATGTAAATATGTATGTAGG + Intronic
1150921428 17:69487835-69487857 TTTTAAGTAAATATTATTGATGG - Intronic
1151254528 17:72865497-72865519 TTTTATGTTGATGTTTATGGTGG - Intronic
1151857443 17:76731897-76731919 GTTTATGCTAATACTTATGAAGG + Intronic
1153020565 18:625101-625123 ATTTATGTTAATATTTAGAACGG + Intronic
1153085973 18:1287965-1287987 TTCTATTTGAATTGTTATGAAGG - Intergenic
1153112816 18:1613013-1613035 TTTTATGTGAATATATAAGGTGG + Intergenic
1153319392 18:3757465-3757487 TTTTGGGTGTATATTAATGAGGG - Intronic
1153418003 18:4871147-4871169 TTCTATATCAATATTTATAAGGG - Intergenic
1153450857 18:5227044-5227066 TTATATGTCAAAAATTATGAAGG + Intergenic
1153532692 18:6065024-6065046 TTCTATGTGTATTTTTTTGAGGG + Intronic
1153863773 18:9242547-9242569 TGTAATGTATATATTTATGATGG + Intronic
1153924251 18:9820421-9820443 TTTTATGTCTATATTCATAAAGG + Intronic
1154955312 18:21248346-21248368 TTTTATGTGAATTTAAATGTTGG + Intronic
1155627244 18:27848662-27848684 TTTGATTTTAAAATTTATGAAGG - Intergenic
1155797309 18:30056468-30056490 TTTGATGTTAATGTTTATTATGG - Intergenic
1155843454 18:30675489-30675511 TATCATGTTAATATTTATCATGG + Intergenic
1156288868 18:35727098-35727120 TTTTGTGTCTATATTTATCAGGG - Intergenic
1156403882 18:36765555-36765577 TTTTATTTTAACATTTATAATGG - Intronic
1157142636 18:45125516-45125538 ATATATGTTAATATTTAGGATGG + Intergenic
1157854092 18:51088254-51088276 TTTTGTGTGAATATTCACAAGGG - Intergenic
1157942173 18:51941230-51941252 GTTCATGTGAAAAGTTATGATGG + Intergenic
1158078287 18:53557998-53558020 TTTTATGTGTATTTTTCTAATGG - Intergenic
1158256102 18:55550794-55550816 TTTGATGTGGATATTTTAGAAGG - Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158601695 18:58861807-58861829 TTTTATATGCATATTAATAAAGG + Intergenic
1158784110 18:60688277-60688299 TTTTAAGAGAAAATTTATGGTGG - Intergenic
1159262043 18:66026730-66026752 TTTTTTATGAATATGTATGTGGG - Intergenic
1159520551 18:69515739-69515761 TTTTATGCCAATATATTTGAGGG + Intronic
1159548193 18:69867136-69867158 TTTTATATGAATATAAATAAAGG - Intronic
1159674103 18:71260351-71260373 TTTTTATTGAATATTTATGATGG - Intergenic
1159967879 18:74614378-74614400 TTTTATGTGGCAAATTATGATGG + Intronic
1160363588 18:78305365-78305387 ATATATGTGTGTATTTATGATGG + Intergenic
1160717531 19:583158-583180 TTTTATGTTTAATTTTATGAGGG + Exonic
1163704643 19:18805015-18805037 TTTTATGTAAATATGAAGGAAGG - Intergenic
1164471409 19:28538335-28538357 TTTTATGTCAAAACTTATGCTGG - Intergenic
1164781313 19:30895875-30895897 TTTCATGTTACTATTTGTGATGG - Intergenic
1167124917 19:47542937-47542959 TTTTATTTATTTATTTATGATGG - Intronic
1167733564 19:51277204-51277226 TTTTGTATGAATATTCATGACGG - Intergenic
1167763828 19:51466468-51466490 TTCTATGTCTATATTTATCAGGG - Intergenic
1167949690 19:53016254-53016276 TTTTACATGATTATTCATGAAGG - Intergenic
925861849 2:8185959-8185981 TTTTTTGTCTATATTCATGAGGG - Intergenic
925873879 2:8295210-8295232 TAAAATTTGAATATTTATGATGG - Intergenic
926495602 2:13582943-13582965 TTTTATGTGTCCATTTATGTGGG + Intergenic
927262569 2:21107483-21107505 TTTTATGTTCATGTTTGTGAAGG + Intergenic
927375945 2:22414203-22414225 TTTTTTGTAAATATTTATATTGG - Intergenic
927570674 2:24156664-24156686 GTTTATGGGAATGTTTAGGAAGG - Intronic
928565599 2:32544763-32544785 TTATATGCCAACATTTATGAGGG - Intronic
929061528 2:37929959-37929981 TATTATGTGAATATTGAGGAAGG + Intronic
929355018 2:41012874-41012896 TTTTATCACAATATATATGAGGG + Intergenic
930300534 2:49610223-49610245 ATTTATATAAATATTTATAATGG + Intergenic
930683030 2:54277982-54278004 ATTTATGTATTTATTTATGACGG + Intronic
930969531 2:57378060-57378082 TTTTAAATGAATATTTTTCATGG - Intergenic
931041045 2:58300828-58300850 TTTTATTTATATATTTATAAAGG - Intergenic
931277891 2:60759952-60759974 TTTTATGTTTATGTTTATGAAGG - Intronic
932290807 2:70577443-70577465 TTTTATTTAAATATATATTAAGG - Intergenic
932413508 2:71560595-71560617 TTTTAATTGAATTTTTAGGATGG - Intronic
932557380 2:72836794-72836816 TTGTATGTGAATATTCATAGTGG - Intergenic
933050805 2:77599006-77599028 TTTTATCTGAATATCTTTGCAGG - Intergenic
933083263 2:78021511-78021533 TTTTATGTTAATTTTTAAAATGG + Intergenic
933339798 2:81009009-81009031 TTATATGTAAATATTTATAGTGG + Intergenic
933529650 2:83490793-83490815 GTTTTTGTGTATATTCATGAGGG - Intergenic
933586110 2:84180954-84180976 TTTTAAATGCATATTTCTGATGG - Intergenic
933860852 2:86465730-86465752 TTTTGTGTGAATATCTTTGAAGG + Intronic
934154700 2:89185872-89185894 TTTTATGTGACTTTTTATTTGGG - Intergenic
934212535 2:89996079-89996101 TTTTATGTGACTTTTTATTTGGG + Intergenic
934919145 2:98328205-98328227 TTTTTTGTGGATATTTATAGGGG - Intergenic
935009089 2:99114265-99114287 TTTTAGGTTTATATTTATGTGGG - Intronic
935285334 2:101559444-101559466 TTTTATGAGAATCTGTATGAGGG + Intergenic
935633145 2:105228527-105228549 TTTTAAGTTAATTTTTGTGAAGG - Intergenic
935680232 2:105629539-105629561 TTTTATTTGAAAAGTGATGATGG - Intergenic
935711113 2:105899519-105899541 TTTTGTGTCAATATTTATCAAGG + Intergenic
935784195 2:106534015-106534037 TTCCATGTGAAAATTTATGTAGG - Intergenic
936291703 2:111229725-111229747 TTTTATGTCTATATTCATGAGGG - Intergenic
936637922 2:114280488-114280510 TTTTATGGAAATATTTGTGATGG + Intergenic
936660741 2:114540902-114540924 TTTTACGAGTATATTTCTGAAGG - Intronic
936705691 2:115070985-115071007 TTGAATATTAATATTTATGAAGG + Intronic
937336411 2:121065034-121065056 GTTAATGTGCATATTTATCAGGG - Intergenic
938132491 2:128729499-128729521 TTTTAAGTTAAAATTAATGATGG + Intergenic
938419888 2:131136680-131136702 TTTTGCGTCTATATTTATGAGGG + Intronic
938753039 2:134353196-134353218 TTTTATTTGAATTTTTATTGTGG - Intronic
939247239 2:139641569-139641591 TTTTGTGTCTATATTTATCAGGG + Intergenic
939370002 2:141286374-141286396 TTTTATGTCTATGTTTATAAAGG + Intronic
939419015 2:141941789-141941811 TTTTAAGTGAATATTTGACATGG - Intronic
939463461 2:142527443-142527465 TTTTATGTTGATATTTATAATGG + Intergenic
940212434 2:151268999-151269021 TTTTATGTTAATATTTATTTAGG - Intergenic
940326257 2:152428345-152428367 TTTTATGTACAGATTTATCATGG + Intronic
940473826 2:154134551-154134573 TTTTCTTTGAATATTTATGTTGG - Intronic
940600232 2:155849096-155849118 TCTTATCTGCATATTTCTGAAGG - Intergenic
941127096 2:161597146-161597168 TTTTATGTCTATATTCATCATGG - Intronic
941216528 2:162716600-162716622 TTTTATATTATTATTTATTAGGG + Intronic
941435256 2:165462527-165462549 ATTTGTGTAAATCTTTATGATGG - Intergenic
941903661 2:170700986-170701008 TTTGACCTGAATATTTTTGAGGG - Intergenic
942264639 2:174209834-174209856 ACTTATGTGAATAGTTCTGAAGG - Intronic
942425863 2:175859892-175859914 TTTTATTTCAATAGTTTTGAGGG + Intergenic
942443766 2:176063952-176063974 TTTTACGTGAATATTTGTTGAGG + Intergenic
942550325 2:177108891-177108913 TTGAATGTGAAGATTTATCAGGG + Intergenic
942811993 2:180010380-180010402 TTTTATGGGAATATTTATTTGGG - Intergenic
942855372 2:180540129-180540151 TTATTGGTTAATATTTATGAAGG - Intergenic
942872511 2:180752483-180752505 TTTTGTGGTGATATTTATGAGGG + Intergenic
943168565 2:184365748-184365770 TTTTGTGTGAATATTTCTGAGGG + Intergenic
943213492 2:185000044-185000066 TCTTTTGTGATTATTCATGAGGG + Intergenic
943429758 2:187784502-187784524 TTATATATATATATTTATGATGG - Intergenic
943721881 2:191213112-191213134 TATTATCTGAATATTGAAGAAGG - Intergenic
943895970 2:193360052-193360074 TTTTATATATATATTTATAAAGG + Intergenic
943944380 2:194040906-194040928 TTTGAATTGAATATTCATGAAGG - Intergenic
944344611 2:198647112-198647134 TTGTATTTGAATATTTGGGAGGG + Intergenic
944475154 2:200095989-200096011 TTTTATATTATTATTTTTGATGG - Intergenic
944863700 2:203840068-203840090 TTTTATAAGGACATTTATGATGG + Intergenic
944874831 2:203951745-203951767 TTTTTTGTGAACATTTCTAAAGG + Intronic
945411895 2:209519582-209519604 ATTTATGTAAATCTTAATGATGG - Intronic
945953477 2:216063200-216063222 TTTTATGTCAATATTTTTAAGGG + Intronic
946390471 2:219412602-219412624 TTTTACATCAATATTTATAAGGG - Intergenic
946457955 2:219844238-219844260 TTTTATATTAATATTTTTTAGGG + Intergenic
946551190 2:220803668-220803690 TTTTAAGTGTATCTTTATGATGG + Intergenic
946785692 2:223241248-223241270 TTTTATATGAGTATTTGGGAAGG - Intergenic
946874963 2:224119647-224119669 TTGGATGTGAATGTTTATCATGG + Intergenic
946975692 2:225147373-225147395 TTTTAAGTTAATTTTTGTGAAGG + Intergenic
947179371 2:227398562-227398584 TTATAAGTGAATTTTAATGATGG + Intergenic
947237783 2:227961785-227961807 TTTTATTTGCATATTCCTGATGG + Intergenic
947324833 2:228962782-228962804 TTTTGTCTGAATCTTTCTGAGGG + Intronic
947686779 2:232094308-232094330 TATTCTGTAAATATTTATTAGGG + Intronic
947813369 2:233019501-233019523 TTTTATATGTATATTTGAGATGG - Intergenic
948255102 2:236562365-236562387 TTTTATGTCTCTCTTTATGAAGG + Intergenic
1169183123 20:3588602-3588624 TTTTGTGTGTACATTCATGAGGG + Intronic
1169639170 20:7729920-7729942 TTTAATGTATATATTAATGATGG - Intergenic
1170308862 20:14971244-14971266 TTTTTTCTGAATATTTTTGATGG + Intronic
1170346471 20:15392411-15392433 TATTATTTTAATTTTTATGATGG + Intronic
1170828408 20:19817610-19817632 TTTTATGTGAATAATATTTATGG + Intergenic
1171110887 20:22481080-22481102 TTTTATTTTAATATTTGTGTTGG - Intergenic
1171904051 20:30885300-30885322 TTTTGTGTCAATGTTCATGAAGG + Intergenic
1172574711 20:35999289-35999311 TTTAATGTTAATATTGATTATGG + Intronic
1173947602 20:46964112-46964134 TTTTATTTGAAGTTTTATAAAGG + Intronic
1173963668 20:47094399-47094421 ATTTATGTGCATATATATGCTGG - Intronic
1174731889 20:52925944-52925966 TTATGGGTGAATATTTATTAGGG - Intergenic
1175026512 20:55908150-55908172 TTCTATGTAAATATTTCTTAGGG + Intergenic
1176206341 20:63890655-63890677 TTTTATATGTATATAGATGAGGG + Exonic
1177073249 21:16538927-16538949 TTAGTTTTGAATATTTATGAAGG + Intergenic
1177144684 21:17394602-17394624 TGTTATTTGAGTATTTGTGAAGG + Intergenic
1177207069 21:18022494-18022516 TTTGATGTAAATATCTTTGAGGG + Intronic
1177354522 21:19990444-19990466 TTTGATGTGCATATTTCTAATGG + Intergenic
1177526410 21:22297014-22297036 ATTTATGAGAATATTTATGGAGG - Intergenic
1177551668 21:22630628-22630650 TTTTATTTTTATATTTATAAAGG - Intergenic
1177582853 21:23050017-23050039 TTATATGTAAACATATATGATGG + Intergenic
1177673276 21:24262466-24262488 TTTTGCGTCGATATTTATGAGGG + Intergenic
1178474855 21:32928874-32928896 GTTTTTGTGCATATTTATGTAGG - Intergenic
1178483255 21:32998693-32998715 TTTTATGTCTATATTCAGGAGGG - Intergenic
1180206268 21:46263014-46263036 TTTTATATCCATATTCATGAGGG - Intronic
1180582496 22:16853134-16853156 GTTTTTTTGAATATTTATCATGG + Intergenic
1182670868 22:31994706-31994728 TTCAATGTGAATTTTTTTGAGGG + Intergenic
1183132216 22:35849514-35849536 ATTTATGTGAAGCTTTATGGTGG - Intronic
1185061325 22:48608340-48608362 TTTTCTCTGAACATTTATGCTGG + Intronic
949144840 3:686647-686669 TTTTATGGGAATAGTCATAAAGG + Intergenic
949149109 3:742985-743007 TTTTAAGTGAATGTGTATTATGG + Intergenic
949470197 3:4387016-4387038 TTTTGTGTCTCTATTTATGAGGG + Intronic
949472203 3:4408074-4408096 TTTTATGTGAAAAATTGTGGAGG - Intronic
949521715 3:4861665-4861687 TTTTATGTCTATATTCATGAGGG + Intronic
949632820 3:5947351-5947373 ATCTATGTAAATATTTATTAAGG + Intergenic
949703933 3:6793715-6793737 TTTTAGATGATTATTGATGATGG + Intronic
949966114 3:9357831-9357853 TGTTATGTGAACTTTTATAAAGG - Intronic
950492768 3:13316230-13316252 TTCTATGTGATTTTTTAAGAGGG - Exonic
951168333 3:19508163-19508185 TTTTATGTCTATATTCATCAGGG + Intronic
951320223 3:21235665-21235687 TTTCATGTGAGTATTTTGGATGG - Intergenic
951607512 3:24452384-24452406 TTTTATGTGAAAATGTTGGATGG - Intronic
951831999 3:26941326-26941348 TTTTGTGTGCATGTTTATGAGGG - Intergenic
951857857 3:27217716-27217738 TTTTGTGTCTATATTTATAAGGG - Intronic
951948362 3:28168590-28168612 TTTTATTTATTTATTTATGATGG + Intergenic
952347212 3:32499554-32499576 TATTTTGTGAATGTTTTTGAGGG - Intronic
952548899 3:34453454-34453476 GTTTATGTGAAAAATGATGATGG + Intergenic
952666729 3:35915711-35915733 TTTTATGTCTATGTTCATGAAGG + Intergenic
952880333 3:37981612-37981634 TTTTATATTATTATTTCTGATGG + Exonic
952984346 3:38764167-38764189 TTTTATTTCAATAGTTTTGAGGG + Intronic
953143556 3:40251707-40251729 TTTTGTGTTTATTTTTATGATGG - Intronic
953299688 3:41760400-41760422 TTTTATTAGAATACTTAGGATGG - Intronic
955231909 3:57107076-57107098 TTTTATTTTAAGAATTATGAGGG + Intronic
955875313 3:63483120-63483142 ATTTATATGAACATTTTTGAAGG - Intronic
956817947 3:72925484-72925506 TTTTATGCGATTATATATAAAGG - Intronic
956980089 3:74626314-74626336 TGAGGTGTGAATATTTATGAAGG - Intergenic
957740205 3:84256275-84256297 TTTTATTTAAAGATTTTTGATGG - Intergenic
958053279 3:88376626-88376648 TTTTATTTGAATATATTTGTAGG - Intergenic
958104752 3:89057469-89057491 TATTATGTGAATTTTTATCATGG + Intergenic
958264075 3:91417255-91417277 ATTTATGTGAATATTTCTAGTGG - Intergenic
958925648 3:100154183-100154205 TTGTATGTGAATATTCATGGTGG - Intronic
959046775 3:101483715-101483737 GTTTGTGTTAATTTTTATGAAGG - Intronic
959181885 3:102991538-102991560 TTTTGTGTTGCTATTTATGAAGG + Intergenic
959469274 3:106729600-106729622 TTTTCTTTGAATATTGAGGAAGG - Intergenic
959499968 3:107095360-107095382 TTTTAAGTTAATTTTCATGAAGG - Intergenic
959720112 3:109477424-109477446 TTTTGTGTCTATATTTATAAGGG + Intergenic
959859622 3:111202666-111202688 TTTTATTTGAATTTTCCTGATGG + Intronic
960014687 3:112873124-112873146 TTTTTTGAGAATTTTTATCATGG + Intergenic
960239067 3:115318790-115318812 TTTTGCGTCTATATTTATGAGGG + Intergenic
960263898 3:115598404-115598426 TTTTATGAGATGATTTATGTTGG - Intergenic
960391913 3:117087709-117087731 ATTTATATGTATTTTTATGAAGG + Intronic
960415304 3:117377847-117377869 TTTTATGTGCAGATTTCTGATGG + Intergenic
960495338 3:118366736-118366758 TTTTGTGTCTATATTTATAAGGG + Intergenic
960733436 3:120751082-120751104 TTTTATAATAATATATATGATGG - Intronic
960819249 3:121710404-121710426 TTTTGTGTTCTTATTTATGAAGG - Intronic
961065500 3:123871859-123871881 TTTTGTGTCTATATTCATGAAGG - Intronic
961219064 3:125185682-125185704 TTTTGTGTATATATTCATGAGGG - Intronic
961486098 3:127217743-127217765 TTTAATGAGAATATTTTTGGTGG - Intergenic
961771138 3:129250763-129250785 TTGGTGGTGAATATTTATGATGG - Intronic
962159788 3:132987037-132987059 TTTTCTGTTGATATTTATTAAGG + Intergenic
962718006 3:138144532-138144554 TTTTAGGTTAATTTTTATGAAGG - Intergenic
963407035 3:144879018-144879040 ATTTATGTTAATAATTAAGAGGG - Intergenic
963426259 3:145129617-145129639 ATTTTTGTGAATATTTATTTTGG + Intergenic
963941341 3:151098741-151098763 TTTGATGTGAATATCTTTTAGGG + Intronic
964152622 3:153545970-153545992 ATTTATTTGTTTATTTATGATGG + Intergenic
964347029 3:155764425-155764447 TTTTATGTTAATTATTTTGAGGG - Intronic
964364748 3:155937977-155937999 GTCTCTGTGAATATGTATGAAGG + Exonic
964431667 3:156613223-156613245 TTGTATGTGAATGTTTATAGTGG - Intergenic
964454149 3:156842379-156842401 TTTTATGTTACTTTTTATGCTGG + Intronic
965122934 3:164586493-164586515 TATTATATGATTGTTTATGATGG - Intergenic
965235041 3:166107576-166107598 TTTTCTATGACTATGTATGAAGG + Intergenic
965415832 3:168391082-168391104 TTTTACATTAATATTAATGAAGG - Intergenic
965431208 3:168591263-168591285 TTTTATTTACATATTTATAAAGG - Intergenic
965432100 3:168601677-168601699 TTTTATGACATTATTTAGGAGGG - Intergenic
965489841 3:169322478-169322500 TTTCATGTGATTTTTAATGAAGG - Intronic
966173386 3:177108942-177108964 TTTTCTGTTAATTTTTAAGATGG - Intronic
966197852 3:177331091-177331113 GTTTGTGTGAATGCTTATGAAGG + Intergenic
966531893 3:180990019-180990041 TTTTATGTTAATAATTGTCAAGG + Intergenic
966634319 3:182115322-182115344 TTGAATGTGCATATGTATGAGGG - Intergenic
967124338 3:186410767-186410789 TTTTATTTGTTTATTTTTGATGG - Intergenic
967625396 3:191677635-191677657 TTATATTTCCATATTTATGAGGG + Intergenic
967770022 3:193324566-193324588 TGTTTTGTGAATATTCAAGAGGG - Intronic
967778617 3:193411540-193411562 TTTTATGAAAATATTCATAAAGG + Intronic
968190373 3:196662821-196662843 TTTTTTGTGAAGAGTTAGGAGGG - Intronic
968259222 3:197306036-197306058 TTTTATTTGCATTTTTCTGATGG - Intergenic
968714328 4:2143743-2143765 TTTTGTGTGTATGTTTATGAGGG - Intronic
968852218 4:3090034-3090056 TTTTATGTAAATATGTTTTATGG + Intronic
969221079 4:5759010-5759032 TCTTATGTGATTATTCATAAGGG + Intronic
970330045 4:14972477-14972499 TTTTGTGTTTATATTCATGAGGG + Intergenic
970631877 4:17955960-17955982 TTTAATGGGATTATTTATGCAGG - Intronic
971328221 4:25661688-25661710 GTGTATGTGAATATATATGCAGG - Intronic
971650635 4:29268125-29268147 TTTGATGAGAAAATTTATAAAGG + Intergenic
971733389 4:30415639-30415661 TTTTTTGTCTATATTTATAAGGG - Intergenic
971773960 4:30936000-30936022 TTTTATGTGTATTTATAAGAGGG - Intronic
971986531 4:33832260-33832282 AATTCTGTGAATATATATGATGG + Intergenic
972032690 4:34481335-34481357 TCTGATGTGAATATCTGTGAAGG + Intergenic
972073108 4:35047784-35047806 TTTTATATAGATATTTATGATGG + Intergenic
972669655 4:41202884-41202906 TTTTATACGAACATTTGTGAAGG - Intronic
972830123 4:42805095-42805117 GTTTGTATGTATATTTATGATGG - Intergenic
973028681 4:45308005-45308027 TTTTAAGTTAAATTTTATGAAGG + Intergenic
973034331 4:45387204-45387226 TTTTGTGTCTATATTTATCAGGG + Intergenic
973214709 4:47656059-47656081 TTTTATGTCAATGTTCATCAAGG - Intronic
973843134 4:54883091-54883113 TTTTACATGAATGTTTATAATGG - Intergenic
973904389 4:55512722-55512744 TTTTGAGTTAATTTTTATGAAGG + Intronic
974411705 4:61549835-61549857 AATAATGTGAATATTTAAGAAGG + Intronic
974522276 4:62997497-62997519 TTTTATATAAGTATTTATGGGGG - Intergenic
974632570 4:64512786-64512808 TTTTAAGTTAATTTTTGTGAAGG - Intergenic
974785540 4:66615467-66615489 TTTTATGTCTATGTTTATCAGGG + Intergenic
974796717 4:66762086-66762108 TTATATCTCAATATTTATTAAGG - Intergenic
974868599 4:67610378-67610400 TATAATCTGAATATGTATGATGG + Intergenic
975057734 4:69956454-69956476 TTTGCTGTAAATATATATGAAGG - Intronic
975300666 4:72787051-72787073 TAGAATGTAAATATTTATGATGG - Intergenic
975354428 4:73384229-73384251 TTTTGAGTTAATTTTTATGAAGG + Intergenic
975654923 4:76632014-76632036 TTTTATCTGAATAATTGGGATGG + Intronic
975896767 4:79102283-79102305 TTTTATGTCTATATTCATCAAGG + Intergenic
975977026 4:80110926-80110948 TTTTGAGTGAATTTTTGTGAGGG - Intronic
976177060 4:82365390-82365412 TTTTAGAAGAATAATTATGATGG - Intronic
976344700 4:83986815-83986837 ATTTATGTGAATATTTATATGGG + Intergenic
976517731 4:85989607-85989629 TTATATGTCTATATTCATGAGGG - Intronic
976562577 4:86519299-86519321 TGTTATGTGCATATATATTAAGG + Intronic
976627524 4:87202879-87202901 TTTTATGTCTGTATTCATGAGGG - Intronic
976667036 4:87606070-87606092 TTTTGTATTAACATTTATGATGG + Intergenic
977005095 4:91557948-91557970 TTTTTTGTGTATTTTTATCATGG - Intronic
977141519 4:93378612-93378634 ATTTAAGTGGATATTTATTAAGG + Intronic
977196588 4:94069472-94069494 TTTTATGTGAAACTTTTTGCTGG - Intergenic
977502899 4:97863669-97863691 TTTTGTGTCAATGTTTATCAGGG - Intronic
977552276 4:98454794-98454816 TTTTAGGTGAATATATATCTAGG + Intergenic
977601684 4:98940090-98940112 TTTTATGTGAATACTTAAACTGG + Intergenic
977936811 4:102815338-102815360 TTTTATCTTAATATTTATTCTGG - Intronic
977991641 4:103450052-103450074 TTTTATGTGAAGAGTTAGAAAGG - Intergenic
978168276 4:105635068-105635090 TTTTATGTGACTATTCCTTAAGG - Intronic
978189060 4:105892517-105892539 TTTTCAGTAAATATTTATTAAGG - Intronic
978345065 4:107758048-107758070 TTTTATGGGAATAATTCTAAAGG + Intergenic
978374536 4:108060988-108061010 ATTTATGGAAATCTTTATGAAGG + Intronic
978487014 4:109266378-109266400 TGTCATGTGAAGATTTCTGAAGG - Intronic
978616742 4:110604866-110604888 TTATATGTGTATATATATAAAGG + Intergenic
978636520 4:110814659-110814681 TCTTATGTGTATATAAATGAGGG + Intergenic
978822825 4:112985554-112985576 TCTCATCTGAAGATTTATGAGGG + Intronic
978823993 4:112999105-112999127 TTTTATTTTAATATTTAAAAGGG - Intronic
979091546 4:116489599-116489621 TCTTACATGATTATTTATGAAGG + Intergenic
979111607 4:116763998-116764020 GTTTTTGTTAATATTTTTGATGG - Intergenic
979143728 4:117213472-117213494 TTTTAAATAAATATTTATGGAGG - Intergenic
979162533 4:117481662-117481684 TTTGAAGTGAATATTTCTGAAGG - Intergenic
979189977 4:117844811-117844833 GATTATGTGAATACTTAAGAAGG - Intergenic
979191633 4:117867472-117867494 TTGTATGTGAATATTTATATTGG + Intergenic
979270393 4:118753490-118753512 TATTAGGTGACCATTTATGATGG + Intronic
979496065 4:121383979-121384001 TTTTATGTATATCTTCATGAGGG + Intergenic
979806213 4:124974827-124974849 TTTTATGTGAAAAATTAAGCAGG + Intergenic
979871154 4:125823810-125823832 TTTTAAGTAAAAATTTTTGAAGG + Intergenic
979903739 4:126257189-126257211 TTTTGTTTGAATAATTATGAAGG - Intergenic
980150102 4:129035520-129035542 GGTTATGTGACTATGTATGAAGG + Intronic
980314019 4:131173064-131173086 TTATATATTAATGTTTATGATGG - Intergenic
980325836 4:131344730-131344752 TTTTATCTGAATAATTTTCATGG + Intergenic
980416363 4:132494001-132494023 TTTTATGTTAGTAGTTTTGAAGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981071731 4:140547623-140547645 ATTTAAGTGTATATTTAAGATGG - Intronic
981108332 4:140906321-140906343 TTTTATTTGTATATTTTTGTTGG - Intronic
981111261 4:140936501-140936523 ATTTATATGAAAATTTATGCTGG - Intronic
981168651 4:141594434-141594456 TTTTATATATATATTTAAGAAGG - Intergenic
981182731 4:141764696-141764718 TTTGATTTGAATTTTTCTGATGG - Intergenic
981348947 4:143706664-143706686 TTTTATGTTAATTTTTATTATGG + Intergenic
981780545 4:148424477-148424499 TTGTATGTAAATATTTATATTGG + Intronic
982285635 4:153731278-153731300 TTTCATGTGTTTATTTATGAGGG - Intronic
982338556 4:154268833-154268855 TTTTATCTGCATTTTAATGATGG + Intronic
982401522 4:154972854-154972876 TTTTATGTGATAATTTCTAACGG + Intergenic
982417452 4:155152584-155152606 AATTATGTGAATATTCAGGAAGG - Intergenic
982498680 4:156126476-156126498 TTTTGAGTTAATATTTTTGAAGG - Intergenic
982589898 4:157295034-157295056 TCTCATGTGAATTTTAATGATGG - Intronic
982666113 4:158265842-158265864 TTTTGAGTTAATATTTGTGAAGG + Intergenic
982739826 4:159045832-159045854 TTTTATGTGAAGACTCAAGAGGG + Intergenic
982952067 4:161711699-161711721 TTTTATATTAATATTCATAAGGG - Intronic
983901006 4:173134161-173134183 TTTTAAGTAAAAAGTTATGAAGG - Intergenic
984298007 4:177878659-177878681 TTTTGAGTTAATTTTTATGAAGG + Intronic
984762368 4:183373889-183373911 TTTTGTGTCTATATTCATGAGGG + Intergenic
986091102 5:4507877-4507899 TTTTGTGACCATATTTATGAGGG + Intergenic
986105266 5:4653785-4653807 TTTCCTGTGACTTTTTATGAGGG + Intergenic
986118790 5:4809353-4809375 TGTTATATGGATATTTATGTAGG + Intergenic
986886537 5:12244606-12244628 TTTAATGTGAAACATTATGATGG + Intergenic
986895451 5:12361060-12361082 TTTTATGTCAGTATATATTATGG + Intergenic
986907315 5:12510864-12510886 TTTAATTTGATTATTTATGGAGG + Intergenic
987560946 5:19519331-19519353 TTTTTTGTGTTTATGTATGAGGG - Intronic
987709253 5:21487715-21487737 TTTAATGTAAATATTTTTAATGG + Intergenic
987944249 5:24584333-24584355 TTTTTTCTGATTATGTATGATGG + Intronic
987952931 5:24699546-24699568 TTTTATATGCATGTTTTTGAAGG + Intergenic
988012638 5:25509939-25509961 ATTCATGTGAATATTTAAGCTGG + Intergenic
988088469 5:26503363-26503385 TTAAATGTCACTATTTATGAGGG + Intergenic
988118425 5:26926975-26926997 TTTTGTGTCAATATTTATCAAGG - Intronic
988262845 5:28911299-28911321 TTTTATATGAATATTGATTCAGG + Intergenic
988422281 5:31020979-31021001 TATTTTATGAATATTTCTGAAGG + Intergenic
988711632 5:33783818-33783840 TTTTATGTGAAAATTTATTTTGG - Intronic
988750359 5:34186442-34186464 TTTAATGTAAATATTTTTAATGG - Intergenic
988873720 5:35420067-35420089 TTTTATGTGAACTTCTATGTTGG - Intergenic
988937017 5:36094402-36094424 TTTAATGTTAATTTTGATGAAGG - Intergenic
988951145 5:36261998-36262020 TGTTAAGTGAAAATTTATCAAGG - Exonic
989068331 5:37484604-37484626 TTTAATGTAAATATTTTTAATGG + Intronic
989637454 5:43551455-43551477 TATAATGTCAATATTTATAATGG - Intronic
989663706 5:43826341-43826363 TTTTATGTGTATGTTCATCAGGG + Intergenic
989999973 5:50881260-50881282 TTGTTTGTGAATGTTTTTGAAGG - Intergenic
990501616 5:56402079-56402101 TTTCATGTGAATATTTATATGGG + Intergenic
990792252 5:59495458-59495480 TTTCATGTCTCTATTTATGAAGG - Intronic
990834021 5:59994811-59994833 TTTTATGTGTATATCTCTAAAGG + Intronic
991231146 5:64333781-64333803 TTTTAAGTGTGTGTTTATGAAGG + Intronic
991248749 5:64535505-64535527 TTCTCTTTGATTATTTATGATGG - Intronic
991326774 5:65442615-65442637 TTTTAGATTTATATTTATGAGGG - Intronic
991738620 5:69649644-69649666 TTTAATGTAAATATTTTTAATGG - Intergenic
991787758 5:70211334-70211356 TTTAATGTAAATATTTTTAATGG - Intergenic
991790195 5:70229384-70229406 TTTAATGTAAATATTTTTAATGG - Intergenic
991814943 5:70504478-70504500 TTTAATGTAAATATTTTTAATGG - Intergenic
991818079 5:70525759-70525781 TTTAATGTAAATATTTTTAATGG - Intergenic
991880203 5:71211701-71211723 TTTAATGTAAATATTTTTAATGG - Intergenic
991882643 5:71229727-71229749 TTTAATGTAAATATTTTTAATGG - Intergenic
992094121 5:73344674-73344696 CTGTATGTGAATATTTATAGTGG - Intergenic
992294724 5:75316639-75316661 TTTTGAGTGTATATTTATGTGGG - Intergenic
992411199 5:76507349-76507371 TTTTATGTTAATTTTTGTGAAGG - Intronic
992434377 5:76741056-76741078 TTGCATGTGAATGTTTATAAAGG - Intergenic
993231501 5:85243588-85243610 TGTTATGTGAAGATTTATCGGGG - Intergenic
993629096 5:90262253-90262275 ATATATGTGCATATATATGAGGG + Intergenic
993655017 5:90567221-90567243 TTTTGTGTCAATATTCATAAGGG + Intronic
993692643 5:91021619-91021641 TTTCATGTGAATCTTTACCAAGG + Intronic
994095725 5:95845863-95845885 TTTTATCTGTTTATTTATGGGGG - Intergenic
994485668 5:100385263-100385285 TTTAATGTAAATATTTTTAATGG - Intergenic
994603608 5:101939562-101939584 CTTTATGTGTATGTTTGTGAGGG + Intergenic
994620075 5:102152263-102152285 TTTTATGAGCATATTTACAATGG - Intergenic
994635188 5:102337729-102337751 TTTTGCCTCAATATTTATGAGGG - Intergenic
994734886 5:103540381-103540403 TTTTATCTTCTTATTTATGATGG + Intergenic
994847586 5:105009671-105009693 TTTTATGTGGATCTTTGTGATGG + Intergenic
994975153 5:106794116-106794138 TTATTTCTGAATATTTCTGAGGG + Intergenic
995008545 5:107231111-107231133 TTTTGAGTGAATTTTTGTGAAGG - Intergenic
995043090 5:107611190-107611212 TTTTATGTCATTATTTTTGTCGG - Intronic
995090970 5:108176515-108176537 AATAATGTGAATATTTATTATGG - Intronic
995423989 5:111998905-111998927 TTCTATGTAAATATTTAAGGTGG + Intergenic
995862589 5:116657499-116657521 TTTTATGATAATATTTATTTGGG + Intergenic
996559364 5:124812181-124812203 CTTTATTTGAATATTTTTGCTGG + Intergenic
996778907 5:127161521-127161543 TTTTGTGTTAATTTTTGTGAAGG + Intergenic
996971959 5:129381072-129381094 TATGATGTCAATGTTTATGAAGG - Intergenic
997054910 5:130430578-130430600 TTTTAAGTTAATTTTTGTGAAGG - Intergenic
997194599 5:131970190-131970212 TTTTGTTTGAAGGTTTATGAAGG - Exonic
997553430 5:134773514-134773536 ATTTGTGTGTATATTTATAAAGG + Intronic
997636932 5:135417293-135417315 TTTTCTGAGAATTTTTATAATGG + Intergenic
998078256 5:139253792-139253814 TTTTATGTGCTTATTTTTGAGGG - Intronic
998242292 5:140457864-140457886 TTTAATGTCAAAATTTATGTAGG - Intronic
998292827 5:140932190-140932212 TTTTCTGTTAATATTCTTGATGG + Intronic
998619150 5:143775174-143775196 CTTTATATGAATACTAATGAGGG - Intergenic
998733362 5:145106648-145106670 TTTTATCTCAATATTAATAAGGG + Intergenic
998862778 5:146460430-146460452 TTTTATTTGATTATTTGTTATGG + Intronic
999038171 5:148376858-148376880 TTTTATTTAAATATTTAGGAAGG + Intergenic
999334335 5:150702402-150702424 CTGTATGTGAATGTTTATAATGG - Intergenic
999798729 5:155012870-155012892 TTTTGAGTGAATTTTTGTGAAGG + Intergenic
999889639 5:155963198-155963220 TTTTTATTGAACATTTATGATGG - Intronic
1000180059 5:158800314-158800336 TTATATGTGAACAAGTATGATGG + Intronic
1000315302 5:160084918-160084940 TTTTAAGTGAATCTAAATGAGGG + Intronic
1000918242 5:167107824-167107846 TTTTATGTGAATATGGCTTAAGG - Intergenic
1000934050 5:167286814-167286836 TTTTATGTAAATATTAATAAAGG - Intronic
1001345068 5:170887447-170887469 TTTTAAGTTAATTTTTGTGAAGG + Intronic
1001348229 5:170929632-170929654 TTTTATATCAGTGTTTATGAAGG + Intronic
1001909065 5:175499398-175499420 TTTTGTGTCTATGTTTATGAGGG - Intronic
1002768868 6:270532-270554 TTTTACCTCAATATTTATAATGG + Intergenic
1003266978 6:4574523-4574545 TTTTTTTTGAAGATTTATGGTGG + Intergenic
1003436784 6:6097116-6097138 TTTTGTGTCTATATTTATGAGGG + Intergenic
1003856126 6:10277645-10277667 TTTTGTGTCTATATTCATGAGGG - Intergenic
1003898382 6:10629891-10629913 TTTTATTTGAAAAAATATGATGG - Intergenic
1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG + Intronic
1004698176 6:18053575-18053597 TTTTAAGTGGATCTTTATGACGG + Intergenic
1005278841 6:24248800-24248822 TTTTAATTTAATATTTATGCAGG - Intronic
1005522992 6:26616255-26616277 TTTTGTGTCTATATTTATGAAGG - Intergenic
1005548428 6:26892750-26892772 TTTAATGTAAATATTTTTAATGG - Intergenic
1005627360 6:27675769-27675791 TTTTGAGTTAATATTTGTGAAGG + Intergenic
1005779604 6:29176019-29176041 TTTTTTGTGACTTTTTATTATGG + Intergenic
1006845833 6:37060855-37060877 TTTTCTGTGAAAATTCATCATGG - Intergenic
1007526087 6:42494819-42494841 TTTTATTTCAATAGTTTTGAGGG + Intergenic
1008101860 6:47400459-47400481 TTTTTGGTGAATAGATATGAAGG - Intergenic
1008201892 6:48600919-48600941 TTTTGTGGTAATATTTATTATGG + Intergenic
1008206765 6:48669546-48669568 TTTTACATGATTATTCATGAAGG - Intergenic
1008708866 6:54198994-54199016 TGTTCTGAGAATATTTAGGATGG + Intronic
1008767686 6:54939386-54939408 TATTATGTGAAAAATGATGATGG + Intronic
1008948048 6:57121041-57121063 TTTTATGTTAATTTTTGTGAAGG + Intronic
1008991358 6:57605734-57605756 ATTTATGTGAATATTTCTAGTGG + Intronic
1009019186 6:57933858-57933880 TTTAATGTAAATATTTTTAATGG - Intergenic
1009179881 6:60503964-60503986 ATTTATGTGAATATTTCTAGTGG + Intergenic
1009287559 6:61840468-61840490 TTTTATTTGATTATTTAAGGAGG - Intronic
1009335517 6:62485134-62485156 GTTTATGTGTATATGTAAGAGGG + Intergenic
1009394747 6:63186670-63186692 TTTTAGGTGAAGATTTAATATGG - Intergenic
1009532686 6:64841280-64841302 ATTTATTTGCATATTTAGGAAGG - Intronic
1009692747 6:67057724-67057746 TTTTATCTCATTATTTATAATGG + Intergenic
1009754878 6:67924226-67924248 TTGTATGCCAATATTTATAACGG - Intergenic
1009984153 6:70762669-70762691 TCTTATGTTAATAATTAGGAAGG + Intronic
1010208851 6:73347254-73347276 TTCTTTCTGAATATTTTTGATGG + Intergenic
1010474860 6:76274730-76274752 TATTAAGTGAACATTCATGATGG - Intergenic
1010508836 6:76692230-76692252 TTATATGTCTATATTTCTGAAGG + Intergenic
1010523470 6:76871297-76871319 TTTTGAGTCTATATTTATGAAGG - Intergenic
1010770282 6:79820466-79820488 TTTTAGATGAATATTTAATAAGG + Intergenic
1010873592 6:81072241-81072263 TTATATTTTTATATTTATGAAGG - Intergenic
1010922315 6:81698107-81698129 TTTTTTGTTCATATTTATGTAGG + Intronic
1011227986 6:85128693-85128715 ATGTATGTGTATATATATGAAGG - Intergenic
1011646662 6:89465434-89465456 TTTAATGTGAATATTTGCAAAGG + Intronic
1011894524 6:92208379-92208401 TTTTATGTAAATACCTTTGATGG + Intergenic
1011904117 6:92339531-92339553 TTATAGGTGAAAATTTATCATGG - Intergenic
1011905591 6:92363251-92363273 TTTTATGTGTGTATTTCTAAAGG + Intergenic
1011985799 6:93443684-93443706 TTTTACATCAATATTTATCAGGG + Intergenic
1012155238 6:95811810-95811832 TTCTATGTCCATATTCATGAAGG + Intergenic
1012334322 6:98035455-98035477 TTTTTTGTTAATATCTATAAAGG - Intergenic
1012977982 6:105800356-105800378 TTTCATGTGAATGTGAATGAAGG - Intergenic
1013002146 6:106033667-106033689 TTTTGTGTCAATATTTATAAGGG + Intergenic
1013083699 6:106836162-106836184 TTTTGTATGAATATTCATCAGGG + Intergenic
1013705365 6:112826721-112826743 TTAAATGTAAATATTTATTATGG + Intergenic
1013721160 6:113029811-113029833 ATATATGTGTATATATATGATGG - Intergenic
1013721161 6:113029837-113029859 ATATATGTGTATATATATGACGG - Intergenic
1014039541 6:116809765-116809787 TTTCATGATAATATTTATGAAGG + Intronic
1014408004 6:121075431-121075453 TTTTATATCTATGTTTATGAAGG - Intergenic
1014408755 6:121087788-121087810 TTTGTTGTAAATATTTATGTGGG - Intronic
1014522520 6:122461941-122461963 TTTTTTGTGTATGTTTATGAGGG - Intronic
1014656145 6:124106861-124106883 TTTAATGTAAAAATCTATGAAGG - Intronic
1014842122 6:126232196-126232218 TTTCATGTATATATTTGTGATGG + Intergenic
1015080119 6:129214018-129214040 TTTTGTGTTAATTTTTGTGAGGG + Intronic
1015989887 6:138928547-138928569 CTTTATGGGAATATTTAAGTAGG + Intronic
1016133935 6:140514192-140514214 ATTTTTGTCTATATTTATGAAGG + Intergenic
1016189515 6:141246437-141246459 GTTTTTGTAAATATTTGTGATGG + Intergenic
1016266083 6:142233959-142233981 TAATTAGTGAATATTTATGAAGG - Intergenic
1017272464 6:152524406-152524428 CTTTATGTGAATATTCATGTAGG - Intronic
1017555777 6:155565852-155565874 TTTTATATGTATGTTCATGAAGG + Intergenic
1017575851 6:155802450-155802472 TTTTATATTCATTTTTATGATGG - Intergenic
1018249406 6:161853265-161853287 TTTTATGTGAATATTGTTTTAGG + Intronic
1018513428 6:164551836-164551858 ATTTATCTGAATATTTATAGGGG - Intergenic
1018514129 6:164560603-164560625 TTTTGTGTCCATGTTTATGAGGG + Intergenic
1018675187 6:166214930-166214952 TTTTATTTTATTTTTTATGAAGG - Intergenic
1021061787 7:16121573-16121595 TTTTTAGTGAATATTGATGGAGG + Intronic
1021181835 7:17516034-17516056 TTTTAAGTCAACATTTATGAAGG - Intergenic
1021325218 7:19258081-19258103 TTTTATGTCCATATTCATCAGGG - Intergenic
1022143920 7:27517825-27517847 TTTAAGGAGAAGATTTATGATGG - Intergenic
1022169879 7:27815554-27815576 TTTTGCATCAATATTTATGAGGG + Intronic
1022886152 7:34646330-34646352 TTGTATGTGAATGTTTATTATGG + Intergenic
1023407920 7:39855570-39855592 TTTTATGTCAACATTCATGATGG + Intergenic
1024126445 7:46302344-46302366 TTTTGAGTCAATATTTGTGATGG - Intergenic
1024144328 7:46496912-46496934 TTTTATGTGAATATCTACCTAGG - Intergenic
1024221347 7:47290220-47290242 TTTTAAGTTAATTTTTGTGAAGG - Intronic
1024484462 7:49902019-49902041 TTTTAAGTTAATTTTTATGAAGG - Intronic
1024489485 7:49962218-49962240 TTTTGTGTCTATATTCATGAGGG - Intronic
1024758117 7:52560830-52560852 CTTCTTGTGAATCTTTATGAGGG + Intergenic
1024791965 7:52975577-52975599 TTTTAAATAAATATTTATGAAGG + Intergenic
1026746051 7:73014030-73014052 TTTTATGAGAATATTTCTCTTGG + Intergenic
1026749704 7:73042174-73042196 TTTTATGAGAATATTTCTCTTGG + Intergenic
1026753352 7:73070284-73070306 TTTTATGAGAATATTTCTCTTGG + Intergenic
1026757003 7:73098320-73098342 TTTTATGAGAATATTTCTCTTGG + Intergenic
1027032156 7:74898589-74898611 TTTTATGAGAATATTTCTCTTGG + Intergenic
1027090403 7:75295166-75295188 TTTTATGAGAATATTTCTCTTGG - Intergenic
1027094048 7:75323094-75323116 TTTTATGAGAATATTTCTCTTGG - Intergenic
1027097691 7:75351061-75351083 TTTTATGAGAATATTTCTCTTGG - Intergenic
1027321656 7:77016608-77016630 TTTTATGAGAATATTTCTCTTGG + Intergenic
1027325291 7:77044531-77044553 TTTTATGAGAATATTTCTCTTGG + Intergenic
1027568376 7:79828989-79829011 TTATATATGAATATTTATTTAGG - Intergenic
1027652128 7:80881016-80881038 TTTTATAAGAATAATTGTGATGG - Intronic
1027721726 7:81751128-81751150 TATTAAATGAATATTTATGGAGG + Intronic
1027810893 7:82896019-82896041 TTGTTTGTGGATATTCATGAGGG - Intronic
1027816494 7:82979046-82979068 TTTTAAGTCAATATTTAAGAAGG + Intronic
1027876040 7:83769911-83769933 TTTGATGTGAATTTTTAATAAGG - Intergenic
1027876089 7:83770731-83770753 TTTGATTGGAATTTTTATGAAGG + Intergenic
1027891171 7:83977602-83977624 TTTTTTCTGATTATTAATGAAGG + Intronic
1028102489 7:86838407-86838429 TTTCATGAAAATATTTAAGATGG + Intronic
1028283094 7:88958113-88958135 ATTTCTGTGAATACTTATCATGG + Intronic
1028740771 7:94272204-94272226 TTAAATGGCAATATTTATGAAGG - Intergenic
1028804974 7:95015134-95015156 CTTCATGTGAAAATTTATAATGG + Intronic
1028867441 7:95730102-95730124 ATTTATGTGAAATATTATGAGGG - Intergenic
1029398792 7:100328061-100328083 TTTTATGAGAATATTTCTCTTGG - Intergenic
1029435072 7:100559415-100559437 TTTTATTTTTATATTTCTGAGGG + Intronic
1030003787 7:105095287-105095309 TTTTGTATTTATATTTATGATGG + Intronic
1030128109 7:106173833-106173855 TTTTAAATGAATTTTTCTGAGGG + Intergenic
1030456369 7:109779722-109779744 TTTTATGTGAAGTTTTAGGTCGG + Intergenic
1030712743 7:112770792-112770814 TTTTATGTGTGTTTATATGAAGG - Intronic
1030721807 7:112880821-112880843 TTGTATGTGTATATTATTGATGG + Intronic
1030754500 7:113271625-113271647 ATTTATGTGACTGTTTATGATGG - Intergenic
1030783398 7:113629015-113629037 TTTAATGTGAAGATTTCTGCTGG + Intergenic
1031299378 7:120044348-120044370 TTATATGTGAGTAATTTTGAAGG - Intergenic
1031431893 7:121681963-121681985 TTTTATATGTACATGTATGAGGG + Intergenic
1031506445 7:122590582-122590604 TTATATATGAATATATATGAAGG - Intronic
1032307521 7:130750247-130750269 CTTTATGTGACTGTTCATGATGG + Intergenic
1032592516 7:133205278-133205300 TATTAGTTGAATATCTATGATGG + Intergenic
1033034193 7:137856753-137856775 TTTTGTGTCAATATTCATCAGGG - Intergenic
1033400913 7:141024167-141024189 TTTTAGGTGCATATATATTAAGG + Intergenic
1033710916 7:143942814-143942836 TTTAATTTGAATTTTTTTGAAGG + Intergenic
1033875209 7:145808840-145808862 TTTAATGTGACTATTAATGTGGG - Intergenic
1033951053 7:146785359-146785381 TTTAAAATGAATATTTCTGATGG - Intronic
1033974648 7:147086132-147086154 TTTAATATGAATATTTTTAAAGG + Intronic
1034763834 7:153698451-153698473 TTTTATATATATATATATGAAGG - Intergenic
1035360394 7:158309620-158309642 TTTTATGTCCGTATTTATAAAGG - Intronic
1035970897 8:4247465-4247487 TTCTATCTCAATATTTATGCAGG + Intronic
1036428149 8:8665441-8665463 TGTGAAGTGAATATTCATGACGG + Intergenic
1036666341 8:10744714-10744736 TTTTGTGTTAATTTTTGTGAAGG - Intronic
1036834086 8:12044302-12044324 TTTAAAGGGAATATTTATGGGGG - Intergenic
1036855930 8:12290867-12290889 TTTAAAGGGAATATTTATGGGGG - Intergenic
1038335784 8:26644216-26644238 TTATATGACAATATTTCTGAGGG + Intronic
1038456892 8:27678769-27678791 TTTTACTTCTATATTTATGAAGG - Intergenic
1038641906 8:29335549-29335571 AGTTAGGTGAATATTTTTGAAGG - Exonic
1038826397 8:31007163-31007185 TTTCATGTAAACATTTCTGAGGG + Intronic
1039168108 8:34709219-34709241 ATGTATGTGAATATATATGTAGG + Intergenic
1040068493 8:43169328-43169350 TTTTATGTTTATATTGAGGAAGG + Intronic
1040485533 8:47868102-47868124 TTTTGTGTTTATATTCATGAAGG + Intronic
1040759381 8:50820526-50820548 TTTTACATAAATATTTATAAGGG + Intergenic
1041159361 8:55022442-55022464 TTTTGTGTCTATACTTATGAGGG - Intergenic
1041507488 8:58616334-58616356 TTTTATATCTATATTGATGAGGG - Intronic
1041528415 8:58835303-58835325 TTTTAATTGTATATATATGATGG - Intronic
1041594728 8:59635310-59635332 TGTTATATGAATATTCATAATGG + Intergenic
1042209065 8:66359809-66359831 TTTTTTGTGTATGTATATGATGG + Intergenic
1042219638 8:66460682-66460704 TTTTATGAAAATTTTCATGAAGG + Intronic
1042870636 8:73395374-73395396 TTTGATGTGAATATAAATGAAGG + Intergenic
1043160013 8:76834903-76834925 TTTTGAGTGAATGTTTCTGAAGG + Intronic
1043226439 8:77736689-77736711 TTTTATGTATATAATTGTGATGG + Intergenic
1043504696 8:80890766-80890788 TTTTTTGTGAATCTTTCTGTTGG + Intergenic
1043611644 8:82070609-82070631 TTTTGAGTTAATCTTTATGAAGG + Intergenic
1043675364 8:82945608-82945630 TTTTAAGTTAATTTTTGTGAAGG - Intergenic
1044072681 8:87782038-87782060 TTTTGTGTCTATATTTATCAGGG - Intergenic
1044074427 8:87801455-87801477 TTTTATGTCAATGTTCATAAAGG - Intergenic
1044141954 8:88666871-88666893 TTTAATGTTAATGTTCATGAGGG - Intergenic
1044182148 8:89209313-89209335 TATTATATGATTATTTATGTAGG + Intergenic
1044405582 8:91822205-91822227 TTTCATGTCAATGTTTATCAGGG - Intergenic
1044463443 8:92475606-92475628 TTTTATCTGAATTATCATGAAGG + Intergenic
1044917025 8:97125452-97125474 TTTTGTGTCTATATTTATGAAGG - Intronic
1045277110 8:100717685-100717707 TTTTAAGTTAATATTTGTCAGGG - Intronic
1045567626 8:103337759-103337781 TTTTATGAGAATTCTCATGAGGG - Intergenic
1045610327 8:103833091-103833113 TTCTTTGTGAATATTTTTGGTGG + Intronic
1045951987 8:107862717-107862739 AGTTATGTGAATAATAATGATGG + Intergenic
1046012160 8:108562214-108562236 TTTTAAGTAAATATTTGTAATGG - Intergenic
1046053405 8:109050785-109050807 TTATATTTGAATATTCATAACGG + Intergenic
1046089217 8:109479133-109479155 TTTAATGCAAATTTTTATGAAGG - Intronic
1046446261 8:114324435-114324457 TTTTATGTTAAGAATTGTGAAGG - Intergenic
1046568218 8:115928703-115928725 TTTTATTTTAATATTTTTGAAGG - Intergenic
1046640938 8:116730690-116730712 TTTTATGGGAACATTCACGAGGG - Intronic
1046964747 8:120151692-120151714 TTATATGTGAATATCTTTGCAGG - Intronic
1047119908 8:121890630-121890652 TTTTGTGTGAATAATTATGCTGG + Intergenic
1047270261 8:123351206-123351228 TTTGATGGGGATATTTATGATGG - Intronic
1047554811 8:125917649-125917671 CTTTATGTGAAAGTTTATTATGG + Intergenic
1048055614 8:130860549-130860571 TTTTGTGTTAATTTTTGTGAAGG + Intronic
1048119015 8:131558453-131558475 TTTTCTGTAAATATCTATTAGGG - Intergenic
1048382022 8:133873816-133873838 TTTTGTGTGAATTGTTATGGAGG - Intergenic
1048562663 8:135558632-135558654 TTTTATGAGATAATTTATGTAGG + Intronic
1049913546 9:294278-294300 ATGTGTGTGAATATTTCTGAGGG + Intronic
1050553566 9:6769844-6769866 ATTTTTGTGAACATTAATGAGGG + Intronic
1050729086 9:8687284-8687306 TTCTATGTTAAAATTTGTGATGG + Intronic
1050806434 9:9684597-9684619 TATTTAGTGAATATTTAAGAAGG - Intronic
1050909168 9:11045289-11045311 TTTAAAGTGCATTTTTATGAAGG - Intergenic
1051090847 9:13405914-13405936 TTTTAAGAGAATATATATGTAGG - Intergenic
1051101167 9:13523575-13523597 TTTCATTTGAATTTTTATGTAGG + Intergenic
1051245407 9:15105773-15105795 TTTTACATCAATATTTATTAGGG - Intergenic
1051287886 9:15514652-15514674 TTGTATGTTAATCCTTATGATGG + Intergenic
1051727263 9:20101196-20101218 TTTTCTGTAAATATGTCTGAAGG + Intergenic
1052659059 9:31404790-31404812 TTTTATGTGTATGTTCATGAGGG + Intergenic
1053161507 9:35816648-35816670 TTTTAGGTGAATGGTTATCATGG + Intronic
1053332376 9:37225510-37225532 TTTTGTGTCTATATTCATGAAGG - Intronic
1053493498 9:38530006-38530028 TTCTGTGTCTATATTTATGAGGG - Intergenic
1054817974 9:69494182-69494204 TTTTATATATATATTTATAATGG + Intronic
1055170902 9:73256185-73256207 TTTTATGTTTATATTCAGGAAGG - Intergenic
1055229390 9:74043455-74043477 GCTTATGTGAATGTTTATGTAGG + Intergenic
1055946506 9:81695960-81695982 TGTTATGTGAATATGTAGGAAGG - Intergenic
1056034438 9:82588588-82588610 TCATATGGGAAGATTTATGAAGG - Intergenic
1056244990 9:84686029-84686051 ATTTATGTGTATATATATGGGGG - Intronic
1056372297 9:85968516-85968538 TGTTATGTGAAAATTTAAGTGGG + Intronic
1057437376 9:95054367-95054389 TTTTATGTTATTATATATGTTGG - Intronic
1057537305 9:95924775-95924797 TTTTATTTTAATTTTTAGGAGGG + Intronic
1057674238 9:97124822-97124844 TTCTGTGTCTATATTTATGAGGG - Intergenic
1057876406 9:98757987-98758009 TTTTGGGTAAATATTTATTAAGG + Intronic
1057876826 9:98762799-98762821 TTTTATATTTATATTCATGAGGG + Intronic
1057933372 9:99215380-99215402 TTTTATGTGTGTATGTATGAAGG + Intergenic
1058049824 9:100394058-100394080 TTTTAAGTGAATATTTAATAAGG - Intergenic
1058369900 9:104254101-104254123 TTTTATGTGATTTTTAATAATGG - Intergenic
1058591929 9:106574654-106574676 TTCTATGTGAATTTATTTGAAGG - Intergenic
1058771926 9:108242848-108242870 TCTTGTGTGAATATTTATTCTGG - Intergenic
1059016718 9:110525496-110525518 TTATATCTGCATATTAATGATGG - Intronic
1059186818 9:112281496-112281518 TTTTATGTCAATATTCATGAAGG + Intronic
1059499893 9:114743093-114743115 TTTTATGTCAATATTTACAATGG - Intergenic
1059847553 9:118297501-118297523 ATATATGTGAATTTTTCTGAGGG + Intergenic
1061646227 9:132004312-132004334 TTTTGCATTAATATTTATGAGGG + Intronic
1062307355 9:135915883-135915905 TTTTTTGGAAATGTTTATGAAGG - Intergenic
1186279972 X:7981657-7981679 TTTAAAGGGAATATTTATTATGG - Intergenic
1187235754 X:17465472-17465494 TTCTTTGTTAATATTTATAATGG + Intronic
1187497676 X:19809694-19809716 TTTTCCATGAATATTAATGATGG - Intronic
1187811960 X:23189287-23189309 TTTAATGTGAATTATTGTGATGG - Intergenic
1188076436 X:25781528-25781550 TTTAATGTGAATATTTTTGCTGG + Intergenic
1188225050 X:27587126-27587148 TGTTATTTAAATATCTATGAAGG + Intergenic
1188338564 X:28970564-28970586 TTATATGTAAAGATTTATTAGGG - Intronic
1188826246 X:34839005-34839027 TTGTATCTGAATATTTATCCAGG + Intergenic
1188890366 X:35604651-35604673 TTTTATATTAAGATTGATGAAGG - Intergenic
1189185082 X:39047825-39047847 TTTCATGTTAATATTCTTGAAGG + Intergenic
1189306182 X:39988381-39988403 TTTTATTTTAACATTTTTGATGG - Intergenic
1189584663 X:42446128-42446150 TTTTATTTGAATAGTTTTGGGGG - Intergenic
1189682302 X:43529263-43529285 TTTGGTGTCAATATCTATGAAGG - Intergenic
1189996020 X:46638929-46638951 TTTTATGTCTGTATTCATGAGGG - Intronic
1190249775 X:48713773-48713795 TTTTATGTGTATATGTCTCAGGG - Intergenic
1190379349 X:49824276-49824298 TTTTGCATGTATATTTATGATGG - Intergenic
1190662015 X:52663523-52663545 TTTTATTTATTTATTTATGATGG + Intronic
1191181458 X:57568202-57568224 TTTGATTTGTATATTTCTGATGG - Intergenic
1191594534 X:62928121-62928143 ATTTCTGTCAATATTTGTGAGGG - Intergenic
1191818852 X:65280124-65280146 TTTTGTGTGTATATTTGTCAGGG - Intergenic
1192079835 X:68036951-68036973 TTTTATGTCAATATTCATCAGGG - Intergenic
1192789299 X:74365653-74365675 TATTATCTGAATACCTATGAAGG - Intergenic
1192801699 X:74471252-74471274 TTTTGTGTGAATTTTTGTGAAGG + Intronic
1192866127 X:75133975-75133997 TTTAAGGTGAATATTAATTAAGG - Intronic
1192903726 X:75526897-75526919 TTTTGAGTTAATTTTTATGAAGG + Intergenic
1192929302 X:75788148-75788170 GTTTATGTGTATATTTATGTTGG + Intergenic
1193063424 X:77231372-77231394 TTTTAAAAGAATATTTGTGATGG + Intergenic
1193211708 X:78814086-78814108 TTTTGAGTCTATATTTATGAAGG - Intergenic
1193303463 X:79921043-79921065 TTTTATTTCAATATTTTTGGGGG + Intergenic
1193446716 X:81614467-81614489 TTTTAGGTGAATATGTATTTAGG + Intergenic
1193517135 X:82479663-82479685 TTTTTTTTCAATATTTATGTTGG - Intergenic
1193734647 X:85142593-85142615 TTTTATGTAAGTATTTCTGCTGG - Intergenic
1194110058 X:89823028-89823050 TTTTATGTCTATGTTTATGAGGG + Intergenic
1194233619 X:91355208-91355230 TTTTGAGTTAATTTTTATGAAGG - Intergenic
1194505762 X:94731446-94731468 TATTGTATCAATATTTATGAGGG + Intergenic
1194528199 X:95006790-95006812 TTTTGAGTTAATTTTTATGAAGG + Intergenic
1194880766 X:99249115-99249137 TTTTATTTGTATATATTTGAGGG - Intergenic
1194890074 X:99367539-99367561 TTTTATATGTATATTCATGTGGG + Intergenic
1194922724 X:99787148-99787170 TTGTCTTTGAATATTTATAAAGG + Intergenic
1195486439 X:105413244-105413266 TATAATGTGAATATTTTTGAGGG - Intronic
1195538975 X:106040781-106040803 TTGTGTGGGAATAATTATGAGGG - Intergenic
1195549933 X:106156871-106156893 ATATGTGTGAAAATTTATGAAGG + Intergenic
1196110408 X:111941078-111941100 GGTGATGTGAATATATATGAAGG - Intronic
1196254654 X:113502424-113502446 TTTTATGTGACTATTTTAAATGG + Intergenic
1196256805 X:113529624-113529646 TCTTACGTGATTATTCATGAAGG + Intergenic
1196295786 X:113995378-113995400 TAATATGTGAATTTTTATCAGGG - Intergenic
1196298936 X:114032153-114032175 TGTAATGTGAATTTTTATCATGG - Intergenic
1196439723 X:115707521-115707543 TATTAAGTGTATATTTATGGTGG - Intergenic
1196503524 X:116412679-116412701 TTTTATGGGAATATTGATTTGGG + Intergenic
1197005736 X:121494993-121495015 TTTTGTGTCAATATTTATAAAGG + Intergenic
1197189237 X:123627188-123627210 ATTCATATGAATAGTTATGATGG - Intronic
1197321710 X:125040235-125040257 ATGAATGTGAATATTTAGGAGGG - Intergenic
1197449685 X:126596110-126596132 TTCTATGTCAATATGTATCACGG - Intergenic
1197485689 X:127048139-127048161 TGTTATATTTATATTTATGAAGG + Intergenic
1198070080 X:133139575-133139597 TTTTATGAGAATATTTATAAAGG + Intergenic
1198650554 X:138859302-138859324 TTTTATTTAAATATTTTGGATGG - Intronic
1198696886 X:139350926-139350948 TTTTGCATCAATATTTATGAAGG + Intergenic
1198721406 X:139624921-139624943 TATTATCTGTATATATATGAGGG + Intronic
1199146861 X:144379231-144379253 TCCTCTGTGAATATTTATGCAGG + Intergenic
1199371949 X:147059427-147059449 TATTATCTGAATTTTTATGAAGG - Intergenic
1199811954 X:151358785-151358807 TTTTTTGTTAGTAGTTATGATGG - Intergenic
1199865570 X:151846895-151846917 TTGTTTGTGAATATTTATAGAGG + Intergenic
1199921776 X:152413385-152413407 TTTTGTGTTTATATTCATGAAGG - Intronic
1200462719 Y:3477764-3477786 TTTTATGTCTATGTTTATGAGGG + Intergenic
1201016856 Y:9613007-9613029 TTTTATGTAAAAATTTAGCATGG - Intergenic
1201759489 Y:17521524-17521546 TAATAGGAGAATATTTATGAAGG - Intergenic
1201842065 Y:18384466-18384488 TAATAGGAGAATATTTATGAAGG + Intergenic
1202050420 Y:20775088-20775110 TTTGATGTGCATCTTTAAGATGG + Intronic
1202581414 Y:26384975-26384997 TTTAATTTGAATACTTATGATGG - Intergenic