ID: 1004642394

View in Genome Browser
Species Human (GRCh38)
Location 6:17527992-17528014
Sequence CACCACCTATGTTTTTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004642394 Original CRISPR CACCACCTATGTTTTTAGAA GGG Intronic
904847070 1:33428471-33428493 GACCACATTTATTTTTAGAATGG - Intronic
908771544 1:67601319-67601341 CTCCACAGATGTTTGTAGAATGG - Intergenic
910154916 1:84205803-84205825 CACCTCCTCTGTTTTTTTAAAGG - Intronic
911341089 1:96638603-96638625 CACAACTGATTTTTTTAGAAAGG + Intergenic
911757184 1:101572268-101572290 CACCACATATATTTATTGAATGG + Intergenic
913287755 1:117242201-117242223 AACCACTGATGGTTTTAGAAAGG - Intergenic
913503248 1:119491169-119491191 CACCACCCACATATTTAGAAAGG + Intergenic
913514266 1:119589562-119589584 CACCACCCAAATATTTAGAAAGG + Intergenic
918283251 1:183025539-183025561 CACTAGCTATGTCTTCAGAAAGG - Intronic
919009744 1:191944970-191944992 CACCACCCAGGGTTTCAGAAAGG + Intergenic
920066131 1:203271124-203271146 CACAACCTGTGTCTTAAGAAAGG + Intronic
921704995 1:218312374-218312396 CACTACAAATGTTTTAAGAACGG - Intronic
921856165 1:219987194-219987216 CACCTCCTTGGTTTTTAGAAGGG + Exonic
921903376 1:220471451-220471473 TACCAGCTATTTTTTTAAAAAGG - Intergenic
1064067703 10:12196578-12196600 CACCACCACTACTTTTAGAATGG + Intronic
1072570101 10:96651030-96651052 CACCACATGTGTTTTGAGAAGGG + Intronic
1073832319 10:107399300-107399322 CTCCACCCATGTTTTTGCAACGG + Intergenic
1074366692 10:112863198-112863220 CATCATCTATGTTTCTAAAAGGG - Intergenic
1075620280 10:123922430-123922452 CAGCATATATTTTTTTAGAAGGG - Intronic
1076302802 10:129440784-129440806 CACCACCTAGGTTTCTCCAAAGG - Intergenic
1078393169 11:10954026-10954048 CTTCACCTATTTTTTTAGACAGG - Intergenic
1079420606 11:20283880-20283902 CACCAACAATGATTTTTGAATGG + Intergenic
1085986992 11:81799853-81799875 CACAAGATATGTTTTTATAAAGG + Intergenic
1086038187 11:82442190-82442212 TAACACCTATGTTTTAAGCAGGG - Intergenic
1088548765 11:110988891-110988913 CTCCACCCATTTTTTTGGAAGGG - Intergenic
1088731200 11:112684573-112684595 CACCTCCTATGTTTTCTTAATGG + Intergenic
1089015527 11:115162249-115162271 CAGTGCCTATGTTTTGAGAATGG + Intergenic
1089618529 11:119709141-119709163 CACCACCTATTTTTGAAGACAGG + Intronic
1091038235 11:132253089-132253111 CAACAACAATGTTTCTAGAATGG + Intronic
1091127448 11:133113447-133113469 AACTACATTTGTTTTTAGAATGG + Intronic
1095225832 12:39675443-39675465 CACCACCTGTGGTAGTAGAAGGG - Intronic
1095389978 12:41694539-41694561 CCCCACATATATTTTTATAAAGG + Intergenic
1098416421 12:70240353-70240375 CACCAACTATCTTTTAAGGATGG + Intergenic
1099518427 12:83628406-83628428 CATCACCTATTTTTTGAGTATGG + Intergenic
1100367536 12:93935453-93935475 CACCAGCTACAATTTTAGAATGG + Intergenic
1105056356 12:133103304-133103326 CACCCCCTTTGTTTTAAGACAGG + Intronic
1105411535 13:20175365-20175387 CACATTCTTTGTTTTTAGAATGG - Intergenic
1105580357 13:21689960-21689982 CATCACCCCTGTTTTCAGAATGG + Intronic
1105998515 13:25696216-25696238 CACCACATCTGTTTATAGAATGG - Intronic
1107209972 13:37841372-37841394 CACCACTTTTATTTTTAAAAAGG - Intronic
1108320810 13:49288625-49288647 CACCAGCTTTGTTGTTAGACTGG + Intronic
1111041199 13:82751009-82751031 CTCCACTTATTTTTTTATAAAGG + Intergenic
1111504510 13:89169522-89169544 CAACACATATGTATTTAAAATGG + Intergenic
1112958456 13:105091016-105091038 CTCCACCTATGTTTCTGCAAAGG + Intergenic
1117436008 14:55715867-55715889 CACCACTTAGCTTTTTAGGAAGG - Intergenic
1117590396 14:57262170-57262192 CAACACCTAATTTTTTAAAATGG + Intronic
1118640806 14:67790540-67790562 CACCACTTATGGTGTTAGCAGGG + Intronic
1122049270 14:99044060-99044082 CACCCCCTGTTTTTTCAGAAGGG + Intergenic
1202918880 14_KI270723v1_random:12623-12645 CACCACCTCTGTTTTTGGCAGGG + Intergenic
1202925750 14_KI270724v1_random:22369-22391 CACCACCTCTGTTTTTGGCAGGG - Intergenic
1125457301 15:39873079-39873101 CAGCACCTGTATTTTTCGAATGG - Intronic
1127754332 15:62076573-62076595 CACCACATATGTTTCTCAAATGG - Intergenic
1128441564 15:67714169-67714191 AAACACTTATGTTTTTTGAAAGG + Intronic
1129563090 15:76592502-76592524 CACCAAACATTTTTTTAGAAAGG - Intronic
1130244322 15:82230369-82230391 CACCACCTCTATCTATAGAAGGG + Intronic
1130456130 15:84110754-84110776 CACCACCTCTATCTATAGAAGGG - Intergenic
1131528498 15:93172064-93172086 TACCACTTAAGTTTTTAGGAAGG + Intergenic
1132128624 15:99252857-99252879 CATCACCTAGGTTTTAGGAAGGG + Intronic
1132192585 15:99880469-99880491 GACCACTTATGTTATTGGAAAGG - Intergenic
1132916342 16:2347775-2347797 AACCACCCATGTTTTTTTAATGG - Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1137997878 16:53239222-53239244 TACAATCTATGTATTTAGAAGGG - Intronic
1143138545 17:4726623-4726645 CACCACCTTTTTTTTGAGACAGG + Intergenic
1146171645 17:30639057-30639079 CCCCACCTATTTTTTGAGACAGG + Intergenic
1146345105 17:32055082-32055104 CCCCACCTATTTTTTGAGACAGG + Intergenic
1150160561 17:62894387-62894409 CACCACCCATCTTTTTGGAGGGG + Intergenic
1150821615 17:68438900-68438922 TAGCACATATGTTTTTAAAAAGG + Intronic
1150880962 17:69027380-69027402 CACCACTTAAGTTTTGAGCAAGG + Exonic
1151001151 17:70378002-70378024 CACGATCTATCTTTTTAGAATGG - Intergenic
1151066914 17:71161319-71161341 CACCACCTATGTTCATGGCATGG - Intergenic
1151805340 17:76401348-76401370 CATCACCTATGTTTGAACAAGGG - Intronic
1153315316 18:3715616-3715638 AACCATCTGTGTTTTCAGAAAGG - Intronic
1153425024 18:4953211-4953233 CACCAGCTATGGTTGTAGAAGGG - Intergenic
1155493028 18:26418345-26418367 TGCCACATATGTTTTTAAAAAGG + Intergenic
1158346662 18:56523282-56523304 CAACACCAATATTTATAGAAGGG - Intergenic
1159133412 18:64307562-64307584 CACCACCTAGATTTTAACAATGG + Intergenic
1160313952 18:77822873-77822895 CACCACCTTCCTGTTTAGAAGGG + Intergenic
1160347812 18:78148982-78149004 CAGCACATATGTTTATAGCATGG - Intergenic
1161897180 19:7091178-7091200 CACCAGCTATGTCCTGAGAAGGG + Intergenic
926485899 2:13457746-13457768 TGTCACCTGTGTTTTTAGAATGG - Intergenic
930326231 2:49922343-49922365 CAGCACCTATGCTTTAGGAAAGG + Intronic
930421984 2:51165590-51165612 CACCAGCTGTGGTTGTAGAAGGG + Intergenic
930919461 2:56734474-56734496 TCCCACCTATGAGTTTAGAATGG - Intergenic
932270517 2:70405034-70405056 AACCACATATGTTGATAGAAGGG + Intergenic
935112709 2:100106730-100106752 CACCACATCTGTTTATACAAAGG + Intronic
937562331 2:123241208-123241230 TACCACCAATATTTTTAGAATGG - Intergenic
942371939 2:175294706-175294728 CATCACCTAGGTATTTGGAAAGG + Intergenic
942588648 2:177515738-177515760 CAGTAGCTATGTTTTAAGAATGG + Intronic
943046088 2:182864003-182864025 TACCACCTATTTTTCTAGCAAGG + Intronic
945029937 2:205654084-205654106 CACCACCTATGTTTGAAGGCTGG - Intergenic
946988058 2:225296399-225296421 CACCATATGTGTTTTTAAAAAGG - Intergenic
1169587982 20:7108064-7108086 CATTACCTGTGTATTTAGAATGG - Intergenic
1170510040 20:17067135-17067157 CACCACCTCTGCCTTTAGTAGGG - Intergenic
1171782843 20:29436941-29436963 CACCACCTCTGTTTTTGGCAGGG + Intergenic
1174043657 20:47717724-47717746 CCCCACCTATGCTTCAAGAAAGG - Intronic
1174680860 20:52406906-52406928 CACCATCTATGTTGTTGCAAAGG + Intergenic
1175362271 20:58422006-58422028 TACCACCTAAGTTTATAAAAGGG - Intronic
1175827174 20:61942578-61942600 CACCACCCTTGTTTTTACAGGGG - Intergenic
1177306196 21:19319757-19319779 CAGAACCAATGTTTTAAGAATGG + Intergenic
1179095781 21:38313484-38313506 CACAATATATGTTTTTAAAAAGG + Intergenic
1181388473 22:22561125-22561147 CCCCATCTATATTTTTAAAAAGG + Intronic
1182362369 22:29754277-29754299 CACCACCTGTGTTTCTGGCAGGG - Intronic
949472902 3:4415306-4415328 CATCACCTGTGTCTTTGGAATGG + Intronic
949562840 3:5218748-5218770 TGCCACCTATGATTCTAGAAGGG - Exonic
949619992 3:5800149-5800171 CCCAACCTATGCTTTTAGAAAGG - Intergenic
949749350 3:7332990-7333012 CACCAGCTATGGTAGTAGAAGGG - Intronic
952070302 3:29626272-29626294 CACAAACTAAGTTTTAAGAATGG - Intronic
953686779 3:45084137-45084159 CACCAGCTCTGCCTTTAGAAGGG - Exonic
954223921 3:49171033-49171055 CCCCACCCAGGTTTGTAGAAGGG + Intergenic
957082645 3:75649648-75649670 CACCACCTCCGTTTTTGGCAGGG - Intergenic
957707051 3:83802453-83802475 CACCACCTCTGTTTACAGCATGG - Intergenic
957770456 3:84685375-84685397 CACCATCCCTGTTATTAGAATGG + Intergenic
964368154 3:155971115-155971137 CATCTCTTATGTTTTTGGAATGG - Intergenic
965911467 3:173782721-173782743 TACCACCCATGATTTTAAAATGG + Intronic
972020758 4:34310603-34310625 CAGCACCTATGGCTTGAGAAGGG + Intergenic
975818335 4:78242873-78242895 CACGACCTGTGATTATAGAATGG - Intronic
976570653 4:86605400-86605422 CACCACCTTTGATCTTAAAAAGG - Intronic
976944405 4:90746618-90746640 CAGCAGCCAGGTTTTTAGAATGG - Intronic
977792777 4:101127834-101127856 CACCTCCTATGGTTACAGAAAGG - Intronic
978318920 4:107471843-107471865 CACCTCCTCTGTTTTTGGAAGGG - Intergenic
980254689 4:130363419-130363441 CACTAACTGTGTTATTAGAATGG + Intergenic
982143550 4:152355910-152355932 GACGACTTAAGTTTTTAGAAGGG + Intronic
983945372 4:173580556-173580578 AACCAACTATGTTTTTAATAAGG - Intergenic
984423789 4:179558015-179558037 CACTGCCTATGTTATTAGTAAGG - Intergenic
988251389 5:28762570-28762592 CACCAATTACTTTTTTAGAATGG + Intergenic
988252765 5:28781762-28781784 CACCATCTGTGTTTTGGGAATGG + Intergenic
988625143 5:32867006-32867028 CACCAACTCTGTTCTCAGAATGG + Intergenic
990272165 5:54154817-54154839 CAACAACTATGTTTTGATAATGG - Intronic
990322294 5:54641765-54641787 CAGCACCCATGATTTTACAAGGG - Intergenic
990355741 5:54964453-54964475 CACCACTTAAGTTTTAAAAAAGG - Intergenic
990803330 5:59630512-59630534 CACCACCCATATTTTCAGGAAGG - Intronic
994088409 5:95785157-95785179 CAACACTTCTGTTTATAGAAGGG + Intronic
998003475 5:138642178-138642200 CACCCCCTATCTCTTAAGAAAGG - Intronic
1003071899 6:2951439-2951461 CACCACCTAATTTTTTTTAAAGG - Intronic
1004540513 6:16545105-16545127 CATCAGCTATGTTTCAAGAAAGG - Intronic
1004642394 6:17527992-17528014 CACCACCTATGTTTTTAGAAGGG + Intronic
1005379637 6:25219860-25219882 CACAACCTTTGTTTTTAAAATGG + Intergenic
1009456210 6:63859541-63859563 TTCCACCTTTGTCTTTAGAATGG + Intronic
1010376803 6:75180123-75180145 CACCACATATCTTTTAAGATGGG - Intronic
1010846090 6:80710140-80710162 CACCATTTATGTTTTCAGAAGGG + Intergenic
1013328554 6:109073454-109073476 CAACACTTATGTTTTTAAAGGGG - Intronic
1013469304 6:110447373-110447395 CAAGACCTCTGTTTTTAGAGGGG - Intronic
1015554919 6:134451523-134451545 CACCACCCCTGCTTTTTGAAGGG - Intergenic
1016108516 6:140191779-140191801 CACCTCCTCTGTTTTTACCAAGG - Intergenic
1016227821 6:141761869-141761891 CAACACATCTGTTTTTAGCATGG + Intergenic
1020048883 7:5067785-5067807 CATCACCTGAGTTTTGAGAAAGG + Exonic
1021161512 7:17278662-17278684 TACCACCTATGCTTTAACAAAGG + Intergenic
1022363057 7:29681787-29681809 CATCACCTTTGTTTTAAAAAAGG - Intergenic
1022698337 7:32731999-32732021 CATCACCTTTGTTTTAAAAAAGG + Intergenic
1023124728 7:36944327-36944349 CACCATCTGTATTTTTAAAATGG + Intronic
1024255098 7:47534739-47534761 CACAACCTGTGTTATCAGAAAGG - Intronic
1024624565 7:51194256-51194278 CTCCATCCATGTTTTTACAAAGG + Intronic
1025223615 7:57137517-57137539 CACCTCCTCTGTTTTTTCAAAGG - Intronic
1027733286 7:81902901-81902923 CACCAGCTGTGTTAGTAGAATGG + Intergenic
1030854525 7:114537081-114537103 TGCCACTTATGTTTTTAAAAAGG + Intronic
1030962358 7:115941995-115942017 CTCCACTGATGCTTTTAGAATGG + Exonic
1031773747 7:125880149-125880171 TACCACCCATGTATTTAGTAGGG + Intergenic
1033615444 7:143010044-143010066 TACCACCTTTCTTTCTAGAAAGG + Intergenic
1035196434 7:157224951-157224973 CACTACCTAAGTTTTTATAAAGG + Intronic
1035943246 8:3928742-3928764 GACCACCTTTGATTTCAGAATGG - Intronic
1035974833 8:4297835-4297857 CACCAGCAATGTTTATATAATGG - Intronic
1036026273 8:4912779-4912801 CACCAGCTATTTTTTTTGGAGGG + Intronic
1037200186 8:16242630-16242652 CACCTCCTATGTTTTATTAATGG - Intronic
1039327536 8:36501789-36501811 CACTAACTAGGTTTTTACAAAGG - Intergenic
1040710460 8:50182304-50182326 CACCACCTAACTTTGGAGAAGGG - Intronic
1043783733 8:84369963-84369985 CACCAGCTATGATTTCAGCAGGG + Intronic
1045964752 8:108012146-108012168 CACTAACTATGTTTTTGGAAAGG - Intronic
1046341571 8:112864926-112864948 TGCCACCTGTGTTTTTATAAAGG + Intronic
1047985302 8:130226978-130227000 AAACACCTATTTATTTAGAAGGG - Intronic
1048694369 8:137008644-137008666 CAAAACCTATCTTTTTGGAATGG + Intergenic
1049924112 9:392396-392418 CCCAACCTCTGTTTTGAGAAGGG + Intronic
1051436347 9:17037029-17037051 CACCACCTCTGTTTTTAACATGG + Intergenic
1051907454 9:22112570-22112592 CACTTCCTTTGTTTTGAGAATGG - Intergenic
1052111882 9:24595793-24595815 CTTCAACTATGTTTTTAGAATGG + Intergenic
1052530111 9:29672181-29672203 CTCCACCTATGTCTGTACAAAGG + Intergenic
1054873889 9:70075334-70075356 CATGACCAATGTTTTTATAAGGG - Intronic
1054878562 9:70121857-70121879 TACCATCATTGTTTTTAGAAAGG + Intronic
1055491075 9:76805917-76805939 AATCACCTATGTCATTAGAAGGG + Intronic
1056435890 9:86575911-86575933 TAACCCCTATGTTGTTAGAAAGG + Intergenic
1057091698 9:92263856-92263878 CACAAATTCTGTTTTTAGAAAGG - Intronic
1057327808 9:94081943-94081965 CAGAACCGATGTTTATAGAATGG + Intronic
1060565336 9:124585902-124585924 CAGCATGTATGTTTATAGAATGG + Intronic
1187239942 X:17503142-17503164 CACAACATGTGTTTCTAGAAGGG + Intronic
1188882622 X:35508048-35508070 TTCCACCTATGTTTTTATGAAGG - Intergenic
1189342903 X:40218112-40218134 CGACAGCTATGTTTCTAGAATGG + Intergenic
1190262648 X:48807424-48807446 CACAACCTGTGTTTTAAAAAGGG - Intronic
1190423648 X:50311051-50311073 GACCAACAATGTTTTGAGAAAGG - Exonic
1195845906 X:109228766-109228788 CTCCACCTCTGTTTTCATAAGGG - Intergenic
1196784322 X:119408786-119408808 CACCATCTCAGTTCTTAGAAAGG + Intronic
1198420304 X:136465126-136465148 CAGCCCCTATGGTTTTAGCAAGG - Intergenic
1199298873 X:146189474-146189496 CAGCATCTATGTGTTGAGAAGGG + Intergenic