ID: 1004642972

View in Genome Browser
Species Human (GRCh38)
Location 6:17533264-17533286
Sequence ACCAATATGCAGTGTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004642972_1004642974 20 Left 1004642972 6:17533264-17533286 CCTTCCACACACTGCATATTGGT 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1004642974 6:17533307-17533329 GTTCATATATTTAAAAATAGAGG 0: 1
1: 0
2: 4
3: 69
4: 585
1004642972_1004642975 23 Left 1004642972 6:17533264-17533286 CCTTCCACACACTGCATATTGGT 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1004642975 6:17533310-17533332 CATATATTTAAAAATAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004642972 Original CRISPR ACCAATATGCAGTGTGTGGA AGG (reversed) Intronic
900767292 1:4513920-4513942 AGCAATAGCCAGTGTGGGGAGGG + Intergenic
901021734 1:6259563-6259585 TCCCATCTGCAGTGTGGGGACGG - Intronic
904254682 1:29247449-29247471 GCCACAGTGCAGTGTGTGGAGGG - Intronic
904369875 1:30041780-30041802 CCCAAGACGCAGTGTGTGGATGG - Intergenic
908518086 1:64913931-64913953 ACCAATGTGCACTTTGTGAAAGG - Intronic
914435255 1:147653930-147653952 CCCAATATGCAGTTTGTGTTTGG - Intronic
915080370 1:153347952-153347974 ACCAATCTGGAGAGTGTGGATGG + Exonic
916712134 1:167420811-167420833 ACCAGTCTGCAGTTTGAGGAAGG + Exonic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
921216967 1:212946094-212946116 ACCAATTTGCAGTTTGAGCAAGG - Intergenic
922174095 1:223181551-223181573 ACATAAATGCAGTGTGTGTATGG + Intergenic
923068633 1:230542885-230542907 AACAAAATGCAATGTGTGGTAGG + Intergenic
1063135457 10:3212888-3212910 ACTAAAATGAAGTGTTTGGATGG + Intergenic
1063318594 10:5032079-5032101 ACCAATCAGCAGGATGTGGATGG - Intronic
1063320574 10:5048716-5048738 ACCATTAGGCAGTGTGCAGAGGG + Intronic
1063712084 10:8489417-8489439 TCTCATATGCAGTGTGAGGATGG + Intergenic
1063769820 10:9184073-9184095 ACCAATCAGCAGGATGTGGATGG + Intergenic
1064757698 10:18586823-18586845 ACCAATAGGCAGGATGTGGGCGG - Intronic
1064792348 10:18972231-18972253 ACAATTAAGCAGTGTGTAGAGGG + Intergenic
1065590495 10:27257448-27257470 ACCAATCTGCAGGATGTGGGTGG + Intergenic
1068180447 10:53511780-53511802 ACCAATAAGGAGTGTGTGTTTGG - Intergenic
1068241027 10:54300830-54300852 ACCAATCAGCAGGATGTGGATGG + Intronic
1069308115 10:66997865-66997887 ACCAATTAGGAGTGTGGGGATGG - Intronic
1070605080 10:77892978-77893000 GCCAGTATGCTGTGTGTGCAGGG + Intronic
1071037320 10:81264150-81264172 ACCAATCAGCAGGATGTGGATGG - Intergenic
1071855302 10:89618305-89618327 ACTAATATACAATGTGTGGGGGG + Intronic
1072086557 10:92085257-92085279 ACCAATGAGCACTGTCTGGATGG - Intronic
1075303881 10:121350318-121350340 ACCACTTTGCAGTGTGTGTGTGG - Intergenic
1075798410 10:125136773-125136795 ACTAATAGGCAGCGTTTGGACGG - Intronic
1080493678 11:32795061-32795083 AGCAATGGGAAGTGTGTGGATGG + Intergenic
1080924555 11:36742803-36742825 GCCAGTATGCAGTGTGGAGAGGG + Intergenic
1081106728 11:39079210-39079232 ACCAATCTGCAGGATGTGGGTGG + Intergenic
1081125209 11:39312875-39312897 ACCAATCAGCAGGGTGTGGGTGG + Intergenic
1081587122 11:44394050-44394072 ACCAGAAAGCAGTGTGTAGAGGG - Intergenic
1082912199 11:58390162-58390184 ACCAATCAGCAGGATGTGGATGG - Intergenic
1084259249 11:67964003-67964025 ACCAATCAGCAGGATGTGGATGG + Intergenic
1086397617 11:86433039-86433061 ACCAATCAGCAGGGTGTGGATGG - Intergenic
1087891112 11:103539153-103539175 ATCAATATACAGTGTGTGAAAGG - Intergenic
1087960235 11:104339406-104339428 ACCAATCAGCAGGATGTGGATGG + Intergenic
1087966415 11:104421765-104421787 ACCAATCAGCAGGATGTGGATGG - Intergenic
1089665457 11:120015083-120015105 ACCAAAAGGAACTGTGTGGAGGG + Intergenic
1089711145 11:120315682-120315704 TCCAAAATGAACTGTGTGGAAGG + Intronic
1090229367 11:125090382-125090404 ACCAATAAGCAGGATGTGGGTGG + Intronic
1090484460 11:127100408-127100430 AGCAATAGGCAGTGTGATGAGGG - Intergenic
1091870189 12:3883386-3883408 TCCAAAAGGCACTGTGTGGAGGG + Intergenic
1092154578 12:6274039-6274061 ACCATTATGCAGTTTGGGGCTGG + Intergenic
1092560425 12:9607458-9607480 ACCAATAGGCAGTGTGCCCAGGG + Intronic
1094320923 12:29182324-29182346 ACCAATCAGCAGGATGTGGAAGG - Intronic
1095551479 12:43446647-43446669 ACAAATGTGGAGTGTGTGGTGGG - Exonic
1100743616 12:97622101-97622123 AACACTATGAAGTTTGTGGAAGG + Intergenic
1101403114 12:104405243-104405265 AGCAAGGTGCAGTGGGTGGAGGG - Intergenic
1101518116 12:105456185-105456207 ACCTAGCTGCAGTGTGTGAAAGG - Intergenic
1101518278 12:105457845-105457867 ACCTAGCTGCAGTGTGTGAAAGG + Intergenic
1101697992 12:107144738-107144760 ACAAACATGCAATATGTGGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105777524 13:23677470-23677492 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1107790934 13:44001666-44001688 ACCAATCAGCAGGATGTGGATGG + Intergenic
1109145518 13:58774049-58774071 ACCAATCAGCAGGATGTGGATGG + Intergenic
1110832496 13:80047286-80047308 TCAAATATACAGTGTGTTGAAGG + Intergenic
1110940163 13:81340365-81340387 ACCAATCAGCAGGATGTGGATGG - Intergenic
1111897911 13:94163920-94163942 ATAAATATGCAGTGTGTAGAGGG + Intronic
1113892155 13:113742148-113742170 TCCAATATGCACTGTGTGCTTGG + Intergenic
1114239305 14:20851428-20851450 ACTAATAAACAGTTTGTGGAGGG - Intergenic
1115060736 14:29186843-29186865 ACCAATCAGCAGGATGTGGACGG + Intergenic
1115238319 14:31229913-31229935 AGCAATAGGCACTGTGTGAAAGG + Intergenic
1116277433 14:42853575-42853597 ACTAATATGCAGTGGGTTTAGGG + Intergenic
1117183506 14:53216866-53216888 ACCAATCAGCAGGATGTGGATGG - Intergenic
1118864200 14:69690077-69690099 ACCAACATGCAGTGTGTGTGAGG + Intronic
1121963934 14:98287253-98287275 ACAGATATTCAGTGTGTGTAAGG + Intergenic
1121994705 14:98593100-98593122 GCCCATGTGGAGTGTGTGGAGGG - Intergenic
1123806742 15:23881504-23881526 ACCAATCAGCAGGGTGTGGGCGG - Intergenic
1125565620 15:40676453-40676475 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1127002136 15:54521614-54521636 ACAAACATGCAGTGTGGGTATGG + Intronic
1127345295 15:58090047-58090069 AAAAAGATGCAGTGTGTGAAAGG + Intronic
1127754025 15:62073163-62073185 TCCAATCTGCAGTCCGTGGACGG + Intergenic
1128144217 15:65323404-65323426 ACAAATATGCAGTCTGGGCAGGG - Intergenic
1130747432 15:86670718-86670740 ATCAATTTGCAGAGTGTAGAAGG + Intronic
1131949287 15:97663382-97663404 ACCAATCAGCAGTATGTGGGTGG + Intergenic
1131977973 15:97964578-97964600 GCCAAAATGCAGGGTGTGGAGGG - Intronic
1132245146 15:100289833-100289855 TTCAATATGTAGTTTGTGGAGGG - Intronic
1133150682 16:3826910-3826932 AACAATAGGAAGTGCGTGGATGG + Intronic
1133926530 16:10197471-10197493 ACAAATATGCAGTGTGTTTTGGG - Intergenic
1136266790 16:29126031-29126053 ACCAGGATGCGGTGTTTGGAGGG + Intergenic
1136266799 16:29126068-29126090 ACCAGGATGCGGTGTTTGGAGGG + Intergenic
1136266811 16:29126125-29126147 ACCAGGATGCGGTGTTTGGAGGG + Intergenic
1138310632 16:56020542-56020564 TCCAATCTGTAGTGTGGGGATGG + Intergenic
1138743172 16:59334014-59334036 ACCAATCAGCAGGATGTGGATGG - Intergenic
1139249225 16:65478884-65478906 AACAATATGAAGTGTTTTGAAGG + Intergenic
1139276001 16:65728222-65728244 ACAAAGCTGCAGTGTGGGGAAGG - Intergenic
1142055645 16:87994013-87994035 ACCAGGATGCGGTGTTTGGAGGG + Intronic
1142055654 16:87994050-87994072 ACCAGGATGCGGTGTTTGGAGGG + Intronic
1142828687 17:2531580-2531602 ACCAATGAGCAGTATGTGGGTGG - Intergenic
1143127863 17:4656103-4656125 ACCAATCAGCAGTATGTGGGTGG - Intergenic
1146527560 17:33579861-33579883 ACCAATAAGCAGGATGTGGGTGG - Intronic
1148906813 17:50917508-50917530 GCCAGCATGCAGTGTGGGGAGGG - Intergenic
1154212791 18:12394509-12394531 ACCAATGTGCTGGGTGTGAACGG + Intergenic
1158597291 18:58827626-58827648 ACCAATCAGCAGTATGTGGGTGG - Intergenic
1158806458 18:60979587-60979609 ACCAGTATGCAGTGTGGGTTTGG - Intergenic
1159260352 18:66005334-66005356 ACCAATCAGCAGGATGTGGATGG - Intergenic
1159295499 18:66481543-66481565 ACCAATATTAAGTGTGTGTGTGG + Intergenic
1160477480 18:79205529-79205551 AACAAAATACAGTTTGTGGAGGG + Intronic
1162440922 19:10691639-10691661 ACCAATATGCTTTGGGTGGACGG + Exonic
1164310600 19:24042319-24042341 ACCAATCTGCAGGATGTGGGTGG + Intronic
1166568247 19:43778067-43778089 AGCAAATTGCAGTGTGAGGAGGG - Intronic
1166582495 19:43914671-43914693 ACAAATATGAAGAGTGTGGGAGG - Exonic
1202640823 1_KI270706v1_random:84569-84591 GCCAACATGCAGTGGGGGGATGG + Intergenic
925901942 2:8515059-8515081 GGCAATATGCACTGTGTGGGGGG + Intergenic
929688522 2:44055426-44055448 TGCAATCTGCAGTGTTTGGAGGG + Intergenic
930068565 2:47346942-47346964 AGAAATTTGCAGTGTTTGGAAGG + Intronic
932983397 2:76697959-76697981 ACCAATCAGCAGGATGTGGATGG - Intergenic
933548872 2:83749025-83749047 ACCAATCAGCAGGATGTGGATGG + Intergenic
934912935 2:98275831-98275853 GCCAATTTGCAGTGGGTAGAAGG + Intronic
938644055 2:133313185-133313207 ACCAATTTGTAGTGTGTGCTGGG + Intronic
939229863 2:139410898-139410920 ACCAATCAGCAGGATGTGGATGG + Intergenic
939553305 2:143642730-143642752 ACAAAAATGCAGTGTTTGGGAGG + Intronic
939851503 2:147311439-147311461 ACCAATCTGCAGGATGTGGTGGG + Intergenic
940328699 2:152452458-152452480 ACCACTACGCAGTGGGTTGAAGG + Intronic
941089717 2:161160622-161160644 ACCAATTTGCAGTTTGGGGAGGG + Intronic
941526412 2:166611525-166611547 ACCAATCAGCAGGATGTGGATGG - Intergenic
942381859 2:175399888-175399910 ACCAAGAAACAGTGTGAGGAAGG - Intergenic
944785702 2:203067318-203067340 GCCTATTTCCAGTGTGTGGAAGG - Intronic
945451367 2:210000096-210000118 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
945578734 2:211565677-211565699 ACAAATATGCAGTGTTTGATGGG + Intronic
948786187 2:240354157-240354179 AGCACCATGCAGTGTGTGGCAGG - Intergenic
1171318713 20:24220198-24220220 ACCAATCTGCAGGATGTGGGTGG - Intergenic
1174548902 20:51346770-51346792 ACAAATATGCAGTCTGGGCAAGG + Intergenic
1174966169 20:55218144-55218166 ACCAATTTTGTGTGTGTGGAAGG - Intergenic
1175218482 20:57403986-57404008 ACCGACATGCAGTGTCTGCAAGG + Intronic
1177371128 21:20205169-20205191 ACCAATCAGCAGGATGTGGATGG + Intergenic
1179427424 21:41292801-41292823 ACCAATTTGCAGGATGTGGGTGG + Intergenic
1182479504 22:30597777-30597799 ACCAATCAGCAGTATGTGGGTGG + Intronic
950825534 3:15815591-15815613 AACAATAAGAAGTGTGTGGGTGG - Intronic
953134757 3:40172845-40172867 CCCAAGATGCAGTGAGTGGATGG - Intronic
954263193 3:49454829-49454851 AGCAATATGGTGTGTGTAGAGGG + Intergenic
954861336 3:53693288-53693310 ACCAATAGGCAGAGTGGGGTGGG - Intronic
956068676 3:65424024-65424046 ACCAATTTGCAATGTGATGATGG - Intronic
957273043 3:78055845-78055867 ACCATGTTGCAATGTGTGGAAGG - Intergenic
957986417 3:87577284-87577306 TCCAAAATACAGTGTGTGGGTGG - Intergenic
959616829 3:108358141-108358163 ACCTACATGCACTGTGTGGATGG - Exonic
961956903 3:130814158-130814180 ACCAATCAGCAGTATGTGGGTGG - Intergenic
963508999 3:146224737-146224759 ACCAATCAGCAGGGTGTGGGTGG - Intronic
964820228 3:160760491-160760513 ACCATGATACTGTGTGTGGATGG + Intronic
966630238 3:182065231-182065253 ACCAAAATTCAGAGTTTGGATGG - Intergenic
967233989 3:187367262-187367284 ACCAATCTGCAGGATGTGGGTGG - Intergenic
967665878 3:192171568-192171590 AACAAAATGTATTGTGTGGAAGG + Intronic
969082875 4:4633354-4633376 CCCAAGATGAATTGTGTGGATGG - Intergenic
969543141 4:7806417-7806439 ACCCAGCTGCACTGTGTGGAAGG + Intronic
970591150 4:17561633-17561655 ACCAGGATGCAGTGGGCGGAAGG + Intergenic
971013835 4:22466870-22466892 CACAATATAGAGTGTGTGGATGG + Intronic
971312416 4:25536751-25536773 CCAAATGTGCTGTGTGTGGAGGG + Intergenic
971790208 4:31160484-31160506 GTGAATATGCAGTGGGTGGAGGG + Intergenic
972926509 4:44015476-44015498 ACCAATATGCATTAGGTGGAAGG - Intergenic
972981500 4:44709217-44709239 ACCATTATGAAGGGAGTGGAGGG + Intronic
974839224 4:67282432-67282454 ACCAATCAGCAGCATGTGGATGG - Intergenic
976933951 4:90604920-90604942 ACCAATCAGCAGGATGTGGATGG + Intronic
979029612 4:115625695-115625717 ACCAATATTCATTGATTGGAGGG - Intergenic
980094849 4:128478979-128479001 AGTAATATGGAGTGGGTGGAGGG - Intergenic
980808177 4:137840529-137840551 ATCACTATGCATTGTGTGTATGG + Intergenic
982171610 4:152667127-152667149 CCCCATCTGCTGTGTGTGGAAGG + Intronic
982773734 4:159421291-159421313 ACCAATCAGCAGGATGTGGATGG + Intergenic
982893503 4:160886169-160886191 ACCAATCAGCAGGATGTGGACGG - Intergenic
983656871 4:170092100-170092122 ACCAATCAGCAGGATGTGGATGG + Intergenic
985328810 4:188803726-188803748 ACAAATAGGCACTGTGTGAAGGG + Intergenic
987673495 5:21044937-21044959 ACCAATCAGCAGTATGTGGGCGG - Intergenic
987793602 5:22599937-22599959 ACAAACATGCAGTATGTGGCTGG - Intronic
989468209 5:41782625-41782647 ACTAATATCCAGAGTCTGGAAGG - Intronic
989971599 5:50531820-50531842 ACCATTATGCAGTGTGTAGAGGG + Intergenic
990436721 5:55799817-55799839 ACTAAAATGGAGGGTGTGGATGG - Intronic
993904969 5:93612476-93612498 AAGAATATGCAGTTTGTGGGTGG - Intergenic
994411297 5:99410266-99410288 ACCAATAAGCAGGATGTGGGTGG - Intergenic
994482532 5:100354981-100355003 ACCAATAAGCAGGATGTGGGTGG + Intergenic
995180814 5:109228675-109228697 GCTAATATGAAATGTGTGGATGG + Intergenic
995180830 5:109228810-109228832 GCTAATATGAAATGTGTGGACGG + Intergenic
995388203 5:111611640-111611662 ACCAATCGGCAGGGTGTGGGTGG - Intergenic
995537562 5:113152633-113152655 GCCAACATGCTGTGTGTGGAGGG - Intronic
997610356 5:135211633-135211655 ACCACTAAGCTGTGTGTGGAAGG - Intronic
997675042 5:135706674-135706696 ACCAAGATGCAGTGTGAAGAGGG + Intergenic
998713693 5:144855761-144855783 ACCAATTTGAAGTGTGTACATGG - Intergenic
1001660552 5:173389259-173389281 ACCAATATGCAGTCTGTTGGAGG + Intergenic
1002431038 5:179203985-179204007 ACCAGTATCCCGTGTGTGGGTGG - Intronic
1003578147 6:7315902-7315924 ACCAATCAGCAGGGTGTGGGTGG + Intronic
1004235400 6:13871255-13871277 ACCAATCAGCAGTATGTGGATGG - Intergenic
1004642972 6:17533264-17533286 ACCAATATGCAGTGTGTGGAAGG - Intronic
1004690004 6:17985616-17985638 AACAATATGCAGTTTGCGGGGGG + Intronic
1005114153 6:22317958-22317980 ACCAATAAGCAGGATGTGGATGG - Intergenic
1005117581 6:22355731-22355753 ACCAATAAGCAGGATGTGGATGG - Intergenic
1005456231 6:26022164-26022186 ACCCATATGTAGTGAGTGGAGGG - Intergenic
1005759951 6:28958884-28958906 ACCAATCAGCAGGATGTGGATGG + Intergenic
1006221402 6:32495144-32495166 CCCAATGAGCAGTGTGTGGAGGG - Intergenic
1006392336 6:33765881-33765903 ACCAACATTCAGTGCCTGGAAGG - Intergenic
1006564189 6:34940352-34940374 ACCAATGTGCAGAGTGTTCAGGG + Intronic
1006864031 6:37193985-37194007 ACCAAGATGCAGGGTTGGGATGG - Intergenic
1007760668 6:44131779-44131801 ACCATTAAGGAGTGTGTGCATGG - Intronic
1008254179 6:49276131-49276153 ACCAATCAGCAGGATGTGGATGG + Intergenic
1009520761 6:64679641-64679663 ACCCAACTGCAGTGTGTGGGAGG + Intronic
1009685496 6:66950261-66950283 ACCAATCAGCAGGATGTGGATGG + Intergenic
1010032718 6:71288125-71288147 ACCAATTTGTAGTGGGTGTAAGG + Intergenic
1010074582 6:71785532-71785554 ACCAATAAGCAGGATGTGAATGG + Intergenic
1011863089 6:91785319-91785341 ACCAATCAGCAGTATGTGGGTGG - Intergenic
1013093434 6:106921928-106921950 AACACTATGCAATGTGTAGATGG - Intergenic
1013145560 6:107387549-107387571 GCTAATATGCAGTGTGTCAAAGG + Intronic
1013487335 6:110609559-110609581 ACTAATAAGCATTTTGTGGATGG - Intergenic
1013694683 6:112688968-112688990 ACCAATCAGCAGGTTGTGGATGG - Intergenic
1016217310 6:141618821-141618843 ACCAATCAGCAGGATGTGGATGG + Intergenic
1018257923 6:161941047-161941069 ACCAATATGGAAGGTGGGGAAGG + Intronic
1021479960 7:21104833-21104855 ACCAATTAGGAGGGTGTGGAGGG + Intergenic
1021572352 7:22079116-22079138 ACCAATAAGCAGGATGTGGGCGG + Intergenic
1022001672 7:26231988-26232010 ACCAAGATGCAGCCTGTGAATGG + Intergenic
1022221607 7:28319552-28319574 ACCGAAAGGCACTGTGTGGATGG - Intronic
1022572160 7:31465458-31465480 ACCAAGAGGAAGTGTGTGGCTGG + Intergenic
1023288861 7:38648040-38648062 ACCAATATGAATTTTGTGTATGG + Intergenic
1023379147 7:39588548-39588570 ACTACTGTGCAGTGTGTGGGGGG - Intronic
1024579021 7:50787112-50787134 ATCAGTATGCAGTGTTGGGATGG - Intronic
1024867584 7:53921392-53921414 ACCAATAAGCAGGATGTGGGTGG + Intergenic
1028404120 7:90457649-90457671 ACCAATAAGCAGTGAGAAGAAGG + Intronic
1028821616 7:95218122-95218144 ACACATTTGCAGTGTGTAGAAGG - Intronic
1030206654 7:106958152-106958174 AACAATATGCAGTGGGTGTCTGG - Intergenic
1030366888 7:108656732-108656754 ACCAATCAGCAGGATGTGGATGG - Intergenic
1030927532 7:115477053-115477075 ACCAATAAATAGTGTGTGGGGGG + Intergenic
1030957981 7:115878856-115878878 AACAATATCCAGTGGCTGGAAGG - Intergenic
1031493092 7:122413120-122413142 AGCAAAATGGTGTGTGTGGAGGG + Intronic
1031513166 7:122673296-122673318 ACCAATCTGCAGGATGTGGATGG - Intronic
1031925346 7:127633286-127633308 ACCATTGTCAAGTGTGTGGAGGG + Intergenic
1032287087 7:130547107-130547129 ACCCATATGCAGTCTTTGCAGGG - Intronic
1032483522 7:132265493-132265515 AGCAATATGAAGGGTGTGTATGG + Intronic
1032505575 7:132431988-132432010 ACCAGTAGGCAGTATGAGGAGGG - Intronic
1032682850 7:134203293-134203315 CACAATATGCAGTGTGTGAATGG - Intronic
1033571374 7:142632114-142632136 AGCAATATGCAGGGGGTGGTGGG + Intergenic
1034967001 7:155397947-155397969 ACCAATCAGCAGTATGTGGGTGG - Intergenic
1036801482 8:11795515-11795537 ACCAATCAGCAGGGTGTGGGTGG + Intergenic
1037263726 8:17036451-17036473 ACCAATCAGCAGGATGTGGATGG - Intronic
1037389704 8:18380670-18380692 ACCACCATGCAGGGTGTGGCTGG + Intergenic
1037957423 8:23070374-23070396 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1039895196 8:41712265-41712287 AGCAATCTGCAGTGTGTTCATGG + Intronic
1040894607 8:52352901-52352923 ACCAATATTCATTTTATGGAAGG + Intronic
1041068664 8:54105164-54105186 ACCAATCAGCAGGATGTGGATGG + Intergenic
1041688312 8:60664723-60664745 AGCAATATGAATTGTGTGGTAGG - Intergenic
1044853672 8:96453006-96453028 ACCAATCAGCAGTATGTGGGTGG + Intergenic
1048224780 8:132574727-132574749 AACAAAAGGCAGTGTGTCGAGGG - Intronic
1052199645 9:25763115-25763137 AACAATATTAAATGTGTGGAAGG + Intergenic
1052364864 9:27600888-27600910 ACCAAGGAGCAGTTTGTGGATGG - Intergenic
1052883756 9:33623565-33623587 AGCAATATGCAGGGGGTGGGGGG + Intergenic
1054832568 9:69643054-69643076 ACCAACAGGCTGTGTGTGGAGGG - Intronic
1055061718 9:72075505-72075527 ACCATTAAGCAGTGTTTAGAGGG + Intergenic
1055102449 9:72479821-72479843 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1055118507 9:72631721-72631743 TTCAATAGGCAGAGTGTGGATGG - Intronic
1055216550 9:73870904-73870926 AGCATTATGCAGTATTTGGAAGG - Intergenic
1058065048 9:100539785-100539807 ACCAATCTGCAGGATGTGGGTGG - Intronic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058585257 9:106500898-106500920 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1059020080 9:110566933-110566955 AGCAATATAAAGTGTTTGGAAGG - Intronic
1059891341 9:118808867-118808889 ACCAATCAGCAGGATGTGGATGG - Intergenic
1187010489 X:15273636-15273658 ACCAATCTGCAGGATGTGGGCGG + Intergenic
1188205278 X:27348235-27348257 ACCAATACGCAGAATGTAGACGG + Intergenic
1188766272 X:34095816-34095838 ACCAATCAGCAGGATGTGGATGG - Intergenic
1189116751 X:38350826-38350848 ACCAATATGAGTTGTGTGTATGG + Intronic
1189209953 X:39276358-39276380 ACCAATCAGCAGGATGTGGATGG + Intergenic
1191610417 X:63105911-63105933 ACATATAAGCAGTGTGTAGAGGG + Intergenic
1192079503 X:68033222-68033244 TCCCAAATGGAGTGTGTGGATGG - Intergenic
1193145737 X:78073821-78073843 ACCAATCAGCAGGGTGTGGGTGG - Intronic
1194250136 X:91564202-91564224 ACCAATCAGCAGGATGTGGACGG + Intergenic
1195552759 X:106186802-106186824 ACCAATCAGCAGGATGTGGATGG - Intronic
1195756738 X:108206123-108206145 CCCAAGATGCAGTGTTAGGAAGG + Intronic
1199831685 X:151554800-151554822 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1200569100 Y:4805451-4805473 ACCAATCAGCAGGATGTGGACGG + Intergenic
1200784387 Y:7246936-7246958 ACCAATAAGCAGGATGTGGGCGG - Intergenic
1201480063 Y:14428976-14428998 ACCAATCAGCAGGATGTGGATGG + Intergenic
1201496793 Y:14597397-14597419 ACCAATCAGCAGGATGTGGATGG - Intronic
1201595788 Y:15667355-15667377 ACCAATCAGCAGTATGTGGGTGG + Intergenic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic