ID: 1004643129

View in Genome Browser
Species Human (GRCh38)
Location 6:17534815-17534837
Sequence TTGAAAAACACGACCCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004643129_1004643131 -1 Left 1004643129 6:17534815-17534837 CCCTGAGGGGTCGTGTTTTTCAA 0: 1
1: 0
2: 1
3: 7
4: 67
Right 1004643131 6:17534837-17534859 ATCTCTAGTCTCCAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004643129 Original CRISPR TTGAAAAACACGACCCCTCA GGG (reversed) Intronic
909504565 1:76373510-76373532 ATTAAAAACACTACCCTTCAAGG - Intronic
912417240 1:109517946-109517968 TTGGGAAACACCACCCCTCAGGG + Intergenic
914435880 1:147658906-147658928 GTGAGAAGCAAGACCCCTCAGGG + Intronic
915589471 1:156862428-156862450 TTGGGAAACACGAGCCCTGATGG - Intronic
1067186855 10:44036552-44036574 TTGGCAAACACTACCCATCAGGG - Intergenic
1069477709 10:68749889-68749911 TTGAAAAAGGCAGCCCCTCAAGG + Intronic
1072391826 10:94994973-94994995 TATAAAAACATTACCCCTCAGGG - Intergenic
1073515771 10:104074399-104074421 ATGTAAAACACGACCCATCATGG + Intronic
1077558568 11:3240822-3240844 TTGAAAAAACAGACCCCTTAAGG - Intergenic
1081483224 11:43507751-43507773 CTGGAAAACACCACCCATCAGGG - Intergenic
1084397526 11:68923070-68923092 TAGGAAAACACAACCACTCAAGG - Intronic
1089878523 11:121750124-121750146 CTGAAAAACACTGCCCTTCAAGG + Intergenic
1091681695 12:2532142-2532164 CTCAAAAGCACAACCCCTCATGG - Intronic
1093119070 12:15245452-15245474 TTGAAGATCACGACCCCTTTTGG - Intronic
1100407710 12:94285645-94285667 TGGAAAAACACGGCCCCAGAGGG + Intronic
1103990344 12:124795014-124795036 CTCAAAACCAAGACCCCTCAGGG + Intronic
1107080943 13:36374126-36374148 TTGAAAAATACAACTCCTCTGGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1110312116 13:74062193-74062215 TTGTAAAAAACGACTCATCATGG + Intronic
1112852820 13:103727906-103727928 TTTAAAAACACAACCCTTAAGGG - Intergenic
1114707970 14:24746720-24746742 TTAAAAAGCACAACCCCTGATGG - Intergenic
1118654587 14:67933211-67933233 ATGGAAAACACTACTCCTCAGGG - Intronic
1119767693 14:77200646-77200668 TGGAAATGCACCACCCCTCAGGG - Intronic
1131394029 15:92072438-92072460 TTGAAAACCACTACCCCTGGTGG - Intronic
1131710732 15:95053415-95053437 TTGAAAAACCAGACCACACAAGG - Intergenic
1133829415 16:9307945-9307967 TTGACAAACACTACACATCAGGG - Intergenic
1134226621 16:12396149-12396171 CTGAAAATCCCCACCCCTCAGGG + Intronic
1145846607 17:28043343-28043365 AAGAAAAACACAACCTCTCATGG + Intronic
1149613430 17:57976097-57976119 TTAAAAAATACTTCCCCTCAAGG + Intronic
1150157634 17:62867656-62867678 TTGAAGAACAAGTGCCCTCATGG + Intergenic
1152346194 17:79753427-79753449 TTGAAAGACATGACCCATCCTGG - Intergenic
1159882116 18:73867887-73867909 TTGACAAACCTCACCCCTCACGG - Intergenic
1160836744 19:1128167-1128189 GTGAGAAACACCAACCCTCAGGG + Intronic
1162669569 19:12243957-12243979 TTGAAAAAAATGTCCACTCAGGG + Intronic
1163282806 19:16327246-16327268 TTGAAAAACAAAACTCGTCAAGG - Exonic
938277467 2:130038604-130038626 TTGAAAAACAGAACTCGTCAAGG - Intergenic
938328437 2:130429407-130429429 TTGAAAAACAGAACTCGTCAAGG - Intergenic
938361509 2:130692087-130692109 TTGAAAAACAGAACTCGTCAAGG + Intergenic
938437916 2:131298776-131298798 TTGAAAAACAGAACTCGTCAAGG + Intronic
1179009303 21:37543157-37543179 TTGCAAAACACTACACCTAAAGG + Intergenic
1179247413 21:39645753-39645775 TTGAGAAACACCACACCCCAAGG + Intronic
1179620258 21:42609862-42609884 TTGAAAGAGACCACGCCTCAGGG + Intergenic
1181037733 22:20178051-20178073 CTGGAAAACAGGACCCCTGAAGG - Intergenic
954810396 3:53243810-53243832 TTTAGAAACAGGACCCCTCAGGG - Intronic
957976771 3:87455874-87455896 TGGAAAAACACAACCTCCCAAGG - Intergenic
960913788 3:122677202-122677224 TTGAAAAACACTACACATCAGGG + Intergenic
962324006 3:134417658-134417680 TTGAAAAACACCAACCATCAAGG + Intergenic
969118874 4:4892257-4892279 TTGAAAAATAAGACCCCCAAAGG - Intergenic
970194505 4:13541798-13541820 TAGAAAAAGGCGCCCCCTCAGGG + Exonic
972198226 4:36679776-36679798 TTGAAAAATACCACCGATCAGGG + Intergenic
977775224 4:100910985-100911007 TTGAAAGACACAAACCATCAAGG - Intergenic
980038385 4:127911086-127911108 GTGAAAAACACAACCCTGCATGG - Intergenic
981499660 4:145436440-145436462 TAGAAAAAAGCGACCCCTCTGGG + Intergenic
984693455 4:182755150-182755172 TTGAAAAGCATGACTGCTCAAGG + Exonic
992487823 5:77211930-77211952 CTGGAAACCACGTCCCCTCACGG - Intronic
992606998 5:78467935-78467957 TTGAAAAGCATGACCCCTAGTGG - Intronic
1000304825 5:159985623-159985645 TTGACAAACACTACACATCAGGG + Intergenic
1001781166 5:174370276-174370298 ATGAGAAACACCAGCCCTCACGG + Intergenic
1004643129 6:17534815-17534837 TTGAAAAACACGACCCCTCAGGG - Intronic
1009941535 6:70294779-70294801 TTTAAAAACACCCTCCCTCATGG + Intronic
1021207664 7:17805132-17805154 TTGAAAAACATGACCACTGGTGG + Intronic
1021330807 7:19337156-19337178 TTGAAAAACAGGGCCCCTCAGGG - Intergenic
1021829392 7:24588599-24588621 TTGAACAACAAGACCCTTAAGGG + Intronic
1024804627 7:53123386-53123408 TTAAAAAACACGACAACTCTGGG - Intergenic
1032976852 7:137234674-137234696 TTGAAAAACATGTCCCCTTAAGG - Intronic
1036771665 8:11582738-11582760 ATGAACAACATGACTCCTCAAGG - Intergenic
1037692903 8:21197754-21197776 TTTAAAAACAGGGCCCCTAAAGG + Intergenic
1037755275 8:21706288-21706310 CTGACAAAAAGGACCCCTCAAGG + Intronic
1048290598 8:133178504-133178526 TTGACAAACAAGACCACCCATGG + Intergenic
1050481943 9:6096827-6096849 TTGAAAAACCCCAACCTTCAAGG - Intergenic
1052844729 9:33325124-33325146 TTGAAAAACACTACACATCCAGG + Intronic
1053584358 9:39441163-39441185 TTTAAATTCACGACCCCTCAGGG + Intergenic
1054105938 9:60999909-60999931 TTTAAATTCACAACCCCTCAGGG + Intergenic
1056511007 9:87305633-87305655 TTAAAAAAGAGTACCCCTCAAGG - Intergenic
1199155797 X:144547642-144547664 TTCAAAAACACGACTGCACAGGG + Intergenic
1199963135 X:152795765-152795787 TTGAAAACGAAGACCCCTGAGGG - Intergenic