ID: 1004651148

View in Genome Browser
Species Human (GRCh38)
Location 6:17610367-17610389
Sequence ATTCAGATTAGTATCTATGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 2, 1: 3, 2: 0, 3: 14, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004651147_1004651148 28 Left 1004651147 6:17610316-17610338 CCAGTTTAATTTTTTGTACTTAG 0: 1
1: 0
2: 17
3: 447
4: 4426
Right 1004651148 6:17610367-17610389 ATTCAGATTAGTATCTATGTAGG 0: 2
1: 3
2: 0
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004651148 Original CRISPR ATTCAGATTAGTATCTATGT AGG Exonic
905000901 1:34668533-34668555 ATTCAGATTAGCATTTCTCTGGG - Intergenic
905946906 1:41909331-41909353 ATTCTGATTAATATTAATGTAGG - Intronic
907319204 1:53592275-53592297 ATCCAGAAGAGTATCTGTGTTGG - Intronic
911129142 1:94371602-94371624 ATTCAGATTTGTAACTATGAAGG - Intergenic
914739253 1:150449877-150449899 ACTCACATTAGTATGTATATTGG + Intronic
918603924 1:186398677-186398699 ATACATATTAGTATCTAATTTGG + Intronic
923481968 1:234393861-234393883 ATTCAGATTTATTTATATGTGGG - Intronic
924583653 1:245343103-245343125 ATTTAGATTAGTGTTTATTTTGG + Intronic
924795535 1:247289746-247289768 ATTCTGTTTAGCATATATGTGGG - Intergenic
1064399519 10:15009862-15009884 ATTCAGAGTAATATCTCTGTAGG - Intergenic
1065097156 10:22292925-22292947 AGTCAGCTTGGTATCTATATGGG - Intergenic
1065166786 10:22987490-22987512 ATAAAGATTAGTATAAATGTTGG + Intronic
1065336990 10:24663072-24663094 GTGCAGATTAGCATATATGTGGG + Intronic
1067471215 10:46539915-46539937 ATACAGAATAGTATCTAAGTGGG + Intergenic
1072093186 10:92149780-92149802 ATTCAGATTAGTAGATCTGGGGG - Intronic
1074376894 10:112948518-112948540 ATTCTGATTAATATCAAAGTTGG + Intergenic
1076409849 10:130239922-130239944 ACTCAGATTATGATCTATCTTGG + Intergenic
1079356153 11:19731681-19731703 ATTGAGTTGAGTAGCTATGTGGG + Intronic
1079492517 11:21005097-21005119 ATTCAGAATAATAACTCTGTAGG + Intronic
1079634725 11:22722117-22722139 TTTCAGATTAGTTTCTAGGTAGG - Intronic
1080527530 11:33141320-33141342 ATTCATATTAGTTTGTAAGTAGG + Intronic
1081360696 11:42174138-42174160 ATTAAGATTAATTTTTATGTGGG + Intergenic
1082675754 11:56099986-56100008 ATTCAGATTACTATGTATATAGG + Intergenic
1087603411 11:100344261-100344283 ATTCAGAAAAGTATTTATCTGGG + Intronic
1087634735 11:100689250-100689272 GTTCACATTAGTGTTTATGTAGG - Intronic
1088513890 11:110606749-110606771 ATTTAGATTTGTCTCTGTGTAGG - Exonic
1091089168 11:132753499-132753521 ATCCAGATATGTATGTATGTAGG - Intronic
1091608921 12:1986146-1986168 ATTCAGACTAGTATATGTATAGG - Intronic
1097215650 12:57410402-57410424 ATTCAGACTAGAGTTTATGTAGG - Intronic
1099560536 12:84168162-84168184 ATTCAGATTGCTATTCATGTTGG - Intergenic
1104002866 12:124871533-124871555 ATTCTGATTAAAATCTATGCAGG - Intronic
1105904493 13:24792943-24792965 ATTCAGATTAATGTCCATGGTGG + Intronic
1106693089 13:32140340-32140362 ATTCAGTTTAGTTTCAAAGTTGG + Intronic
1107902516 13:45031694-45031716 ATTGGGATTAGTCTCTCTGTGGG - Intronic
1110006589 13:70279083-70279105 ATTGAGTTTTGTATTTATGTTGG + Intergenic
1112257407 13:97847534-97847556 AATCAGATTAGTACTTATTTAGG + Intergenic
1114259893 14:21029021-21029043 CTTCAGATAAGTTTCTATGCAGG - Intronic
1115699713 14:35939923-35939945 ATTCAGATTATTTTCTACATAGG - Intergenic
1116158945 14:41241819-41241841 ATACACAATAGTATTTATGTGGG + Intergenic
1120535314 14:85688127-85688149 ATTCAGAGTAGTATGGGTGTTGG + Intergenic
1122103157 14:99429769-99429791 ATTCAGATGGGTTTCTATATTGG - Intronic
1133846777 16:9461972-9461994 ATTCAGAGTAGTGTCTTGGTTGG + Intergenic
1140553645 16:75895000-75895022 TTTAAGATTAAAATCTATGTGGG - Intergenic
1140712832 16:77694189-77694211 ATTTTCATAAGTATCTATGTGGG + Intergenic
1140961856 16:79921188-79921210 ATTCAGATTAGTATTTAGTCTGG - Intergenic
1141131663 16:81441665-81441687 ATTCAGATTCCTTTCTAGGTTGG + Intergenic
1144117737 17:12116052-12116074 AGTCAGATGAGTATCCCTGTAGG + Intronic
1149130967 17:53302079-53302101 ATACAAAGTAGTATGTATGTAGG + Intergenic
1150683924 17:67305040-67305062 AGTTAGATTAGACTCTATGTTGG - Intergenic
1150753779 17:67891349-67891371 ATTTAGATAATTATCTGTGTAGG - Intronic
1151772667 17:76174861-76174883 ATTCAGATTACTCACTTTGTGGG + Intronic
1153132912 18:1878067-1878089 ATACAGATGAGTTTCTATCTTGG - Intergenic
1153245618 18:3070492-3070514 ATCCAGATTAGAAATTATGTTGG + Intronic
1156004047 18:32419295-32419317 ATTCAGCTTATTATCCATGGAGG - Intronic
1157459589 18:47876811-47876833 ATTTAGATGTGTATATATGTAGG - Intronic
1157540012 18:48494630-48494652 ATGCAGATGAGTATCCTTGTGGG + Intergenic
1158790146 18:60769684-60769706 ATTCTGATTATTATCTAGGAAGG + Intergenic
1159701151 18:71629617-71629639 ATTCAGATTAGTCGAAATGTAGG + Intergenic
1161432144 19:4238833-4238855 ATTCAGATTAGCAGTTAGGTTGG + Intergenic
926539817 2:14161627-14161649 TTTCAGAATTATATCTATGTTGG + Intergenic
928468685 2:31550938-31550960 AATCACATGATTATCTATGTGGG + Intronic
929016270 2:37499471-37499493 ATTCTTATTATTTTCTATGTGGG - Intergenic
929067586 2:37994955-37994977 AGTCAGATCAGTATTTGTGTAGG + Intronic
930306620 2:49682761-49682783 ACTCAAATTTGTATATATGTGGG + Intergenic
930632490 2:53768756-53768778 ATTGAGATTAATGTCTTTGTAGG - Intronic
930682788 2:54274849-54274871 ATTCTGCTTTGTATCCATGTTGG - Intronic
931103367 2:59027788-59027810 CCTCATATTAGTATCTATGGTGG - Intergenic
931824559 2:65986490-65986512 ATTCAAATGAGTATTTATTTTGG + Intergenic
935469586 2:103441643-103441665 ATTCCGATTAATATCCATGAAGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
941115344 2:161465485-161465507 ATTCAGAATATGATCTATATTGG + Intronic
941335195 2:164234150-164234172 ATTCAGATGAGTACCAATGCAGG - Intergenic
941474700 2:165936156-165936178 GATCAGTTTACTATCTATGTGGG - Intronic
942953796 2:181750980-181751002 ATTCAGACTAGTAGGCATGTGGG - Intergenic
943526730 2:189025701-189025723 ATTCAGCTTAGTTGGTATGTTGG + Intergenic
943738817 2:191388606-191388628 AGTCAGATTAGAACATATGTTGG + Intronic
945532090 2:210968119-210968141 ATTCAACTTAGTATCTCTTTGGG + Intergenic
945600340 2:211855085-211855107 TTTCTGATTAGTAATTATGTTGG + Intronic
1169702494 20:8463350-8463372 ATTCAGATCAGTGGTTATGTTGG - Intronic
1176275781 20:64267689-64267711 ATTCAGGTTAGCATCTTTGCAGG + Intronic
1177466776 21:21494698-21494720 TTTCACATTATTATGTATGTTGG - Intronic
1181904402 22:26182548-26182570 ATTCACAGTAGTATCTATATTGG - Intronic
1183202916 22:36398308-36398330 ATTGAAATAAGAATCTATGTGGG + Intergenic
1184014755 22:41777655-41777677 ATTCAGATTTGGGTCTATTTGGG + Intronic
1184825001 22:46944011-46944033 ATTTAGTATAGTTTCTATGTGGG + Intronic
949307330 3:2657474-2657496 TTTAAGATTAGTATTTATTTTGG + Intronic
952369271 3:32704217-32704239 ATTTAGATTTGTAAGTATGTGGG + Intronic
953596280 3:44317842-44317864 ATTCATAAAAGTATTTATGTTGG + Intronic
955220892 3:57022398-57022420 ATTCAGATCAGTACAGATGTGGG - Intronic
955847603 3:63183019-63183041 AATCACATTAGTCTCTGTGTGGG - Intergenic
956872256 3:73429557-73429579 ATTCTGATTAGTATTTACTTTGG + Intronic
957738006 3:84226917-84226939 GTTCTGATTAGTGTCTATCTGGG + Intergenic
960687717 3:120311103-120311125 AGTCAGATATGTATCTATGTCGG + Intergenic
961334812 3:126167051-126167073 ATTCAGATTAGTATCTACGTAGG + Intronic
963437836 3:145294223-145294245 TTTCAGATAAGTTTCTATGGTGG + Intergenic
963577463 3:147078780-147078802 AATGGGATTAGTATCTTTGTAGG + Intergenic
964462344 3:156948042-156948064 ATTCAAATTAGAATCCTTGTTGG - Intronic
964787224 3:160410343-160410365 ATTCAAGTTTGTATCTACGTAGG - Intronic
965175703 3:165329126-165329148 ATACAGCTTACTATGTATGTAGG + Intergenic
965840407 3:172899083-172899105 ATCCAGAATAGCATCTATTTTGG + Intronic
969907638 4:10411807-10411829 AGTCAGATGAGTATCCCTGTAGG + Intergenic
974731255 4:65869138-65869160 ATTCAGATTAGGGACTATGCAGG - Intergenic
975110148 4:70614341-70614363 ATTCAGTTTAGTTTCTTTATAGG - Intergenic
975379394 4:73680927-73680949 ATTTGGATAAGTATATATGTTGG + Intergenic
977064488 4:92296442-92296464 ATTCAGACTTGTATCTCTGAAGG + Intergenic
978698051 4:111606990-111607012 AATCCTATTAGTATCTATGTAGG - Intergenic
981463814 4:145042343-145042365 ATTCAGATTCTTAAGTATGTTGG - Intronic
982049088 4:151481762-151481784 GTTTTGTTTAGTATCTATGTTGG + Intronic
985143212 4:186864210-186864232 ATTCAGATCAGTATTTCTGTAGG + Intergenic
987559562 5:19501580-19501602 ATTCAGAGTTATACCTATGTAGG + Intronic
988403017 5:30787046-30787068 ATTCAGATAAGAAACTATTTTGG + Intergenic
991166098 5:63566535-63566557 ATTCAGATTGGTCTCCATCTGGG - Intergenic
992792428 5:80225503-80225525 CTTCACATTTGTCTCTATGTTGG - Intronic
993599914 5:89909247-89909269 ATTCAGATTTGTATCCATAAAGG + Intergenic
993659387 5:90612496-90612518 ATTCAGTTAAGTGGCTATGTAGG - Intronic
993779230 5:92045169-92045191 ATTCAGCTTCGTATCTATATGGG + Intergenic
996606087 5:125324547-125324569 TTTCAGATTAGTATAATTGTTGG + Intergenic
998306975 5:141088033-141088055 ATGCAGATTTGGATCTATGTGGG - Intergenic
998515788 5:142752746-142752768 ATTCAGATTAGAATCTAGTGAGG - Intergenic
1004651148 6:17610367-17610389 ATTCAGATTAGTATCTATGTAGG + Exonic
1005157677 6:22825698-22825720 ATTCAAATTTGTATTTATGAAGG - Intergenic
1006714819 6:36110464-36110486 ATTCAGAGCAGTATTTCTGTAGG - Exonic
1014407898 6:121074019-121074041 TTTCAGAATATTATCTATCTTGG - Intergenic
1014984808 6:127991391-127991413 ATTCAAATTAATTTCTTTGTAGG - Exonic
1015105767 6:129534331-129534353 ATTTTGATTAGTATCTTTATAGG + Intergenic
1015645363 6:135381405-135381427 TTTCATATTAATGTCTATGTGGG - Intronic
1016255585 6:142101496-142101518 CTTCAGATTATTTTCTTTGTAGG + Intergenic
1017202603 6:151772297-151772319 ATTCAGATTGGTGCATATGTTGG - Intronic
1017230864 6:152072195-152072217 CTTCATTTTAGTATCTATATAGG + Intronic
1017521346 6:155205916-155205938 ATTCAGATTACGAGCTGTGTGGG + Intronic
1017742249 6:157417153-157417175 TTCCAGAATTGTATCTATGTGGG + Intronic
1017798715 6:157872075-157872097 ATTCAGATTATTAACTAATTAGG + Intronic
1017890729 6:158636642-158636664 AGTCAGATGAGTATCCCTGTAGG - Exonic
1020415006 7:7935503-7935525 ATCCAGATTAGAATCTATGCAGG - Intronic
1021591311 7:22266002-22266024 ATTCATATTACTTTCTTTGTTGG - Intronic
1021592824 7:22282544-22282566 ATTAAAAATAATATCTATGTGGG - Intronic
1022280577 7:28904804-28904826 ATTCCCATTAGTATCTTTGGAGG - Intergenic
1023084913 7:36560992-36561014 TTTCTGAATAGTATCTATGGGGG + Intronic
1023525309 7:41096392-41096414 ATTCAAAAGAGTGTCTATGTAGG - Intergenic
1024259866 7:47566014-47566036 TTTCAGATTAGTATACATATTGG + Intronic
1027128908 7:75576735-75576757 ATGCAGATTAGAATCTACCTGGG - Intronic
1030734816 7:113035141-113035163 CTTCAGATTATTATCGAAGTGGG - Intergenic
1031289294 7:119912584-119912606 ATCCAGATTATGATCTATTTTGG + Intergenic
1032833093 7:135648841-135648863 ATTCAGAATAATATCTCTATGGG - Intergenic
1036134104 8:6143131-6143153 ATTAAAATTAGTATCCATATGGG - Intergenic
1040904062 8:52447149-52447171 GTTCAGAATATTATTTATGTAGG - Intronic
1042724797 8:71861840-71861862 ATTCAGGTTAGAATATATTTAGG - Intronic
1042899075 8:73703774-73703796 AAGCAGATTAGTAGCTGTGTGGG + Intronic
1043112732 8:76208377-76208399 ATGCAGATTATAATCTAAGTAGG - Intergenic
1043312783 8:78882588-78882610 ATTTAAATTCATATCTATGTGGG + Intergenic
1045893062 8:107181112-107181134 ATTCATTTTGGTATGTATGTGGG - Intergenic
1045901417 8:107285631-107285653 ATTCAAAATAGTTTCTTTGTAGG + Intronic
1046352683 8:113036143-113036165 AATAAAATTAATATCTATGTTGG + Intronic
1046705533 8:117446627-117446649 ATTCAGATTAGTATCTGATGGGG - Intergenic
1050518096 9:6466823-6466845 AGTCAAATGAGTATCTGTGTAGG - Intronic
1055880972 9:81002785-81002807 AATTAGATTAGTAGCTATCTAGG + Intergenic
1056745562 9:89298672-89298694 ATTCGGATTAGTATCTATGTAGG + Intergenic
1059406799 9:114104340-114104362 GTTGAGATTAGCATCTATGGTGG - Intergenic
1186406328 X:9306998-9307020 ATTCAGATTCTTTTCTCTGTAGG - Intergenic
1187585143 X:20652195-20652217 AATCAGTTTTGTATCTATGTTGG - Intergenic
1188973640 X:36647350-36647372 ATTCTGATTCTTATCTTTGTGGG + Intergenic
1190412416 X:50150227-50150249 ATACAGATTATTATATATGGGGG - Intergenic
1195242295 X:102964326-102964348 ATGCAGATTAATTTCTATTTAGG + Intergenic
1196232809 X:113243996-113244018 ATTCAGATAAGTATAGAAGTTGG + Intergenic
1197303642 X:124813126-124813148 ATTCAGATTGCTTACTATGTTGG - Intronic
1198739665 X:139828153-139828175 AGTCAGTTAAGTATCTATGCTGG + Intronic
1200877880 Y:8178294-8178316 ATTCAGACTAGTATCCATATAGG - Intergenic
1202033876 Y:20610995-20611017 ATTAAGATTAGTATCTATGTAGG + Intergenic
1202237384 Y:22727246-22727268 ATTCAGATTAGTATCTATGTAGG + Intergenic