ID: 1004653793

View in Genome Browser
Species Human (GRCh38)
Location 6:17638382-17638404
Sequence CTGGAGAAACAGATCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004653793_1004653799 9 Left 1004653793 6:17638382-17638404 CCATCTGTGATCTGTTTCTCCAG 0: 1
1: 0
2: 5
3: 27
4: 384
Right 1004653799 6:17638414-17638436 CCAAAGAAAAAGAAATTAAAAGG No data
1004653793_1004653800 26 Left 1004653793 6:17638382-17638404 CCATCTGTGATCTGTTTCTCCAG 0: 1
1: 0
2: 5
3: 27
4: 384
Right 1004653800 6:17638431-17638453 AAAAGGAGAGAAGATGTAGAAGG 0: 1
1: 1
2: 4
3: 92
4: 916

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004653793 Original CRISPR CTGGAGAAACAGATCACAGA TGG (reversed) Intronic
900791270 1:4682503-4682525 CAGGAGCCACAGAGCACAGATGG - Intronic
902186056 1:14726295-14726317 CAGGAGAATCAGAGCACACAGGG + Intronic
902903980 1:19540745-19540767 CTGAAGAAAGAAATCAAAGAAGG - Intergenic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
902980251 1:20117615-20117637 TGGGAGAAACAGATGGCAGAAGG + Intronic
905294271 1:36944337-36944359 CTGGAGATAAATATCAGAGATGG + Intronic
905823672 1:41013827-41013849 CTGAAAAAAGAGATCCCAGATGG + Intergenic
906654595 1:47538449-47538471 CAGCACAAACAGCTCACAGAGGG - Intergenic
907035841 1:51215472-51215494 CTGAAGAATCAGCTCACAAAAGG - Intergenic
909219179 1:72932445-72932467 CTGGAGCAAGAGATCACCGGTGG + Intergenic
909273906 1:73660119-73660141 CTGCTGAAACAAATCAGAGATGG + Intergenic
910415795 1:86996665-86996687 ATGGAGAAACAGACAACTGAAGG + Intronic
910478476 1:87633927-87633949 CGGAAGAATCAGATCACACATGG + Intergenic
911040059 1:93584275-93584297 CTGGAGAAACAAATTACTGATGG + Intronic
911484567 1:98489265-98489287 TGGGAGAAAAAGATCAAAGAGGG - Intergenic
912095735 1:106140700-106140722 CTGGAGAGATAGATATCAGAAGG + Intergenic
912202455 1:107473453-107473475 ATGGAAAAACTGACCACAGATGG - Intronic
912247350 1:107973874-107973896 CTGGACAGGCAGAACACAGAAGG + Intergenic
915642198 1:157237058-157237080 CTGGAGCAATAGATTACAGGTGG + Intergenic
916185559 1:162129204-162129226 GAGGAAAGACAGATCACAGAGGG - Intronic
916211205 1:162361335-162361357 ATGGGGAAACAAAGCACAGAGGG + Intronic
916426993 1:164690150-164690172 CTGGAGAGCGAGAGCACAGAGGG - Intronic
918080909 1:181207057-181207079 CTGGAGACACAGGAGACAGAAGG + Intergenic
918536733 1:185583066-185583088 CTGGAGAAAAAGAGCACACAGGG + Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919343014 1:196337651-196337673 CTGGAGAAAGAGATAACAGCTGG - Intronic
920435768 1:205946062-205946084 CTAGGGAAACAGAAGACAGAAGG + Intergenic
921124952 1:212169293-212169315 CAACAGAAACAGATCCCAGAAGG + Intergenic
921336903 1:214096889-214096911 CTGCTGAAAGAAATCACAGATGG + Intergenic
921407360 1:214795526-214795548 CTGATGAAAGAAATCACAGATGG - Intergenic
921742881 1:218706658-218706680 CTGAAGAATCACTTCACAGATGG - Intergenic
922080817 1:222294137-222294159 CTGGACAACCAGATCTCAGCAGG + Intergenic
922548719 1:226478076-226478098 CAGAAGAAACAGCTCAAAGAGGG - Intergenic
922985732 1:229864846-229864868 CGGGAGAACAAAATCACAGAGGG + Intergenic
923225111 1:231931953-231931975 CTGGTGAAAAATATCACAGGTGG - Intronic
923351788 1:233114614-233114636 CTGGATAAACAGAAAACTGATGG + Intronic
923727333 1:236518291-236518313 CTGGTGAATCAGATCATAGGGGG + Intronic
923922400 1:238582460-238582482 CTGGTGAACCATATCAAAGAGGG + Intergenic
924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG + Intergenic
1063019907 10:2117274-2117296 CAGAAGAATCAGATCACACATGG + Intergenic
1063706399 10:8435204-8435226 CTGGAAACACAGGTTACAGAAGG - Intergenic
1064199403 10:13271901-13271923 CGTGAGAAACAGAAAACAGATGG - Intergenic
1064765027 10:18661941-18661963 CAGGAGAACCTTATCACAGAGGG + Intronic
1065841276 10:29703512-29703534 CTGGAGAACCAGCTGACAGAAGG - Intronic
1067101087 10:43335198-43335220 AGGGAGAAAAGGATCACAGAAGG + Intergenic
1067170845 10:43904607-43904629 CTGGGGAAACAGCTTGCAGAGGG - Intergenic
1068452255 10:57206988-57207010 CTAGAGAAACTGACCACAGGAGG + Intergenic
1069183691 10:65395723-65395745 TAGTAGAAACAGATAACAGAAGG - Intergenic
1069190270 10:65478745-65478767 CTGGAGAAACAGACAAGAAAAGG + Intergenic
1069209088 10:65733679-65733701 CAGAAGAATCAGATCACACATGG - Intergenic
1070611988 10:77939687-77939709 CTGGAGAAACAGCTGCCAGATGG + Intergenic
1074521708 10:114231183-114231205 CCTGAGCAACAGATTACAGAGGG - Intronic
1074711160 10:116178729-116178751 CTGGAGAAACATACTCCAGAAGG + Intronic
1074961158 10:118447411-118447433 CTGGAGGAACAGATCACCTGAGG - Intergenic
1075339422 10:121633457-121633479 CTGTAGATAGAGATCACACAGGG - Intergenic
1075576118 10:123578774-123578796 CAGGAGTAACAGAGGACAGATGG + Intergenic
1076759626 10:132595739-132595761 CTGCAGAAAAATATTACAGAAGG - Intronic
1079281315 11:19089637-19089659 CTGGGGAAACAGGTCAGACAAGG - Intergenic
1079382542 11:19950722-19950744 CTGGAAAATCAGCTCACAAAAGG + Intronic
1080619932 11:33978832-33978854 CTTGAGAAAGTGATGACAGATGG - Intergenic
1080744643 11:35097892-35097914 CTGGAGTAACACATGCCAGAGGG - Intergenic
1084379016 11:68798763-68798785 CAGGAGAAACAGCTCACGGGAGG + Intronic
1084486903 11:69453486-69453508 CCAGAGAAACAGAACCCAGAGGG + Intergenic
1084873684 11:72115118-72115140 ATGGAGACACAGGTCACAGAAGG - Intronic
1085466795 11:76729617-76729639 CTAGAGAAACTGTTCACACAGGG + Intergenic
1087783915 11:102332604-102332626 GTGAAGAAATAGATCCCAGATGG - Intronic
1088807278 11:113364133-113364155 CTGGAGACCCAGCTGACAGATGG + Intronic
1090270701 11:125383993-125384015 CTGGGGAGACAGACCAGAGAGGG + Intronic
1091009569 11:131986399-131986421 CTACAGAAAAAGATTACAGAAGG + Intronic
1091118436 11:133036988-133037010 CGGGAGAAACAGAACACTGTGGG - Intronic
1091325945 11:134687793-134687815 CTGGTGAAAGAGATCAGTGATGG - Intergenic
1092050165 12:5463586-5463608 ATGGAGAAAAAGACCACTGAAGG + Intronic
1092704770 12:11270236-11270258 CTGGGCACACAGATGACAGAAGG + Intergenic
1093952532 12:25180269-25180291 CTGCTGAAAGAAATCACAGATGG + Intronic
1095149913 12:38780866-38780888 CTGAAGGAAATGATCACAGATGG + Intronic
1095794894 12:46207926-46207948 CTGAAGAAAAAGATCACAGAAGG - Intronic
1096428345 12:51522862-51522884 CTGCAGTAACATAACACAGATGG - Intergenic
1099156678 12:79185447-79185469 CTGGAGAAATCTAACACAGAAGG - Intronic
1099308298 12:80985631-80985653 CTGTAGAAAAAGTTCACAGAAGG - Intronic
1100292537 12:93231542-93231564 CTGGGGGAAGAGATCACAAATGG - Intergenic
1100650234 12:96579226-96579248 CAGGACAAAGAGAACACAGAAGG - Intronic
1101213606 12:102559597-102559619 CTGGAGAAACAGGTAAGAGCAGG - Intergenic
1103152206 12:118650618-118650640 CTGAAGGAACAGAACAGAGACGG - Intergenic
1103326330 12:120123562-120123584 CTAGAGAAATAGCTCACAGGAGG + Intergenic
1106865602 13:33960646-33960668 CTGGAAAATCAGTACACAGAAGG + Intronic
1107232153 13:38123003-38123025 CTGGAGAAAGAGAGCATGGAGGG + Intergenic
1107415508 13:40196274-40196296 ATGGATAAGCAGCTCACAGAAGG + Intergenic
1107449285 13:40493743-40493765 CTAGAGGGACAGATGACAGAAGG + Intergenic
1107659074 13:42620694-42620716 CAGAAGAAATAGATCACTGATGG - Intergenic
1108081741 13:46744367-46744389 CTGGAGAAAGAGAATACAAATGG - Intronic
1109378526 13:61526640-61526662 CGGAAGAATCAGATCACACACGG + Intergenic
1109421287 13:62115682-62115704 CTGGAGAATCAGATCACACCTGG - Intergenic
1109559613 13:64029738-64029760 CGGGAGAATCAGATCACACCTGG - Intergenic
1109651286 13:65330677-65330699 CGGGAGAATCAGATCACACTTGG + Intergenic
1110835186 13:80074743-80074765 CGGAAGAATCAGATCACACATGG - Intergenic
1111140123 13:84106093-84106115 CTGGAGAAAAAGTTAACAGGGGG + Intergenic
1111554247 13:89859241-89859263 CTATAGAAACATATCACAGCAGG - Intergenic
1111880900 13:93955838-93955860 CTGGAGAAAAAGAAGATAGAAGG - Intronic
1112218455 13:97460950-97460972 CCGGAGAAACTGATCAAAGGAGG - Intronic
1114075580 14:19159526-19159548 ATGGATAAACAGTTTACAGATGG - Intergenic
1114086581 14:19240046-19240068 ATGGATAAACAGTTTACAGATGG + Intergenic
1114866524 14:26600787-26600809 CTGAAGAAAGAAATCAGAGAAGG - Intergenic
1114916121 14:27267413-27267435 ATGGAGAAATGGATGACAGATGG + Intergenic
1115163932 14:30426768-30426790 CTGGAGAAACAGGTTACCTATGG - Intergenic
1116032606 14:39590711-39590733 CTAGAGAAGCAGAGCAGAGAAGG - Intergenic
1118630753 14:67700413-67700435 CCAGAGAAAAAGATTACAGAAGG + Intergenic
1118991396 14:70800230-70800252 CTTGAGATACCCATCACAGAAGG - Intronic
1119219991 14:72898811-72898833 CTGGAGGAACATATCAGAGCTGG - Intergenic
1119692433 14:76686492-76686514 AAGGAGAAAAAGATCACAAAGGG - Intergenic
1120690733 14:87589792-87589814 CAGGAGGAACAAATCACAGCTGG + Intergenic
1121527284 14:94627897-94627919 CTGGAGGTACAGACTACAGAAGG + Intergenic
1202898118 14_GL000194v1_random:21664-21686 ATGGATAAACAGTTTACAGATGG + Intergenic
1124077684 15:26461616-26461638 CTGTTGAAACAGAGCTCAGAGGG + Intergenic
1125701647 15:41691063-41691085 CTGAAAAAAAAAATCACAGATGG + Intronic
1125760702 15:42093892-42093914 TTGGAGAAACACATGACAGAGGG + Intronic
1126353286 15:47767680-47767702 CTGGTGCAACAGTTAACAGAAGG - Intronic
1128249435 15:66154053-66154075 TTGGAGAAGCAGACCACTGAGGG - Intronic
1130144897 15:81266631-81266653 CTAGAGATAGAGATCAGAGAAGG - Intronic
1130744764 15:86639226-86639248 CAGGAGATAGAGATCACTGAGGG + Intronic
1130961391 15:88660926-88660948 CAGGAGATAGAGATCACTGAGGG - Intergenic
1133715334 16:8441731-8441753 CGGGAGAAAGAGCACACAGACGG - Intergenic
1135892527 16:26370504-26370526 CTGGAGATAAAGATGACACAGGG - Intergenic
1136097244 16:27965933-27965955 ATGGAGAGACAGATCACAGAGGG - Intronic
1136735619 16:32463837-32463859 CTGCTGAAAGAAATCACAGATGG - Intergenic
1137554677 16:49463118-49463140 CTGGAGAGACAGAGAAGAGAAGG - Intergenic
1137612970 16:49831364-49831386 TTGGAGAAACAAATCATATAGGG + Intronic
1137810633 16:51349527-51349549 CTGAAGAAGCAGAACACAAAAGG - Intergenic
1138192953 16:55031566-55031588 CGGGAGAGACAGATAACAGGTGG + Intergenic
1139699858 16:68701508-68701530 CAGGAGAAACAGATCCTGGAAGG - Intronic
1140031407 16:71342108-71342130 CTGGAGAACCAGGTCGGAGATGG + Intergenic
1140516235 16:75544309-75544331 CTGTAGAAGCAGGTCAGAGAAGG + Intronic
1140654048 16:77121738-77121760 CTGGAGAAACAGTTCTCAGATGG - Intergenic
1140657023 16:77151557-77151579 CTGGAGGATCAGATTAGAGATGG - Intergenic
1141458866 16:84164395-84164417 ATGAAGAAGCAGAGCACAGAGGG - Intronic
1141797708 16:86286257-86286279 CTTAATAAACAGATCCCAGAAGG - Intergenic
1142143765 16:88484097-88484119 CTGGAGAAACAAAGCAAAGCAGG + Intronic
1203017459 16_KI270728v1_random:365732-365754 CTGCTGAAAGAAATCACAGATGG + Intergenic
1203035794 16_KI270728v1_random:638890-638912 CTGCTGAAAGAAATCACAGATGG + Intergenic
1145056272 17:19706006-19706028 CTGGAAAGACAGACCACACAGGG - Intronic
1147916180 17:43888302-43888324 CTGGGGAAACAGACAACTGATGG + Intronic
1151178337 17:72307366-72307388 GTAGAGAATCAGATCACATAAGG - Intergenic
1151772708 17:76175514-76175536 GAGGAGAAACAGGCCACAGATGG - Intronic
1152768424 17:82153200-82153222 CTGGTAAAACAGATTGCAGATGG + Intronic
1152813358 17:82392667-82392689 CTGCAGAAGCAGTTCCCAGAGGG - Intronic
1153541263 18:6158688-6158710 CTGTAGAAAGAGATCCCACATGG + Intronic
1154060552 18:11055959-11055981 CTGGGGAACCAGATCTCGGAAGG - Intronic
1155634888 18:27940912-27940934 CCAGAGAAACAGGTCAGAGATGG - Intergenic
1155712695 18:28902938-28902960 CTGGAGAAGCTGCTCCCAGATGG + Intergenic
1155821667 18:30385751-30385773 TTGGAGAAACAGATAACATTAGG + Intergenic
1156556607 18:38075570-38075592 CCAGAGAAACAGATCTAAGAGGG + Intergenic
1156766487 18:40662898-40662920 CTGGAGAACGAGATCACATGTGG + Intergenic
1156888904 18:42167116-42167138 CTGGAGGAACATATCACACAGGG - Intergenic
1157562247 18:48656630-48656652 CTGGCAGAACAGATCACAGAGGG - Intronic
1160345886 18:78131497-78131519 CTGGACAAAACCATCACAGAAGG + Intergenic
1161843445 19:6696238-6696260 GAGGGAAAACAGATCACAGATGG + Intronic
1161919356 19:7254679-7254701 TGAGAGAAACAGATCACTGAAGG + Intronic
1162325572 19:9997204-9997226 CCAGAGAAATAGTTCACAGATGG + Intronic
1163488152 19:17601718-17601740 CTGGAGACACAGGTCACAGGCGG - Exonic
1165295817 19:34925301-34925323 CAGAAGAATCAGATCACACATGG + Intergenic
1165560319 19:36673717-36673739 CTAGAGAAACAGAACAAACAGGG - Intergenic
1165873865 19:38992035-38992057 ATGGGGAAACAGTTTACAGACGG + Intronic
1167119862 19:47510370-47510392 CTGGAGAAATAGGTGGCAGAGGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167950836 19:53026352-53026374 CTGGGGAAGCAGATCAGATAGGG + Intergenic
1168068968 19:53938395-53938417 AAGGAGAAACTGATCAGAGATGG + Intronic
925613618 2:5724604-5724626 CTGGAGAAGCTTAACACAGAAGG - Intergenic
925857699 2:8146271-8146293 CAGGAGAAACACCTCCCAGATGG - Intergenic
927011113 2:18905383-18905405 CTTGAGAAACAGAACAAAGCAGG - Intergenic
927571326 2:24163341-24163363 CCGTAGAAACAGATGACAGCTGG + Intronic
927769577 2:25847687-25847709 CTGGATAAATAGTTCACAAAAGG + Intronic
928120331 2:28579328-28579350 ATGGAGGAACAGAGCTCAGAGGG + Intronic
928417615 2:31109340-31109362 CACGAGAAACAGATAACAGAAGG + Intronic
928537002 2:32250748-32250770 CTGTATCAACAGATCATAGAAGG + Exonic
928753983 2:34502036-34502058 CCAGAGAAACAGAGCAGAGAAGG - Intergenic
929728130 2:44454649-44454671 ATAGAGAAACAGATCAGAAATGG - Intronic
929883536 2:45858402-45858424 CAAGGGAAACAAATCACAGAGGG - Intronic
930258831 2:49121853-49121875 CTGAAGATACAGATCACGAAAGG - Intronic
931767344 2:65468485-65468507 CTGGGGCATCAGATCACAGAGGG + Intergenic
932627170 2:73307101-73307123 CGAGAGAGACAGATCAGAGATGG - Intergenic
932703302 2:74004976-74004998 CTGGAGATACAGAGGAGAGAGGG - Intronic
933207290 2:79521787-79521809 ATGCAGAAACAGGTGACAGAGGG + Intronic
934310199 2:91856160-91856182 CTGCTGAAAGAAATCACAGATGG + Intergenic
935452496 2:103225877-103225899 CTGCAGCAAAAGCTCACAGAGGG + Intergenic
936278982 2:111121988-111122010 CTGGGGCAACAGGTCCCAGAGGG - Intronic
936409683 2:112246078-112246100 ATGGAGCAACAGAGCCCAGATGG + Intronic
937236919 2:120436733-120436755 CTGGAGAAACGGAGCAGAGGAGG - Intergenic
937542885 2:122981199-122981221 CTGGAGATACAGATCAAATCAGG + Intergenic
938490170 2:131757026-131757048 ATGGATAAACAGTTTACAGATGG - Intronic
938622740 2:133073543-133073565 CTGGAACCACAGCTCACAGAAGG + Intronic
938669035 2:133569461-133569483 TTGGGGAGACAGAACACAGATGG - Intergenic
939296346 2:140269661-140269683 CTGGACAATCAGATCATGGAGGG + Intronic
939519090 2:143206542-143206564 ATTGAGAGACAGATCAAAGAAGG - Intronic
939958890 2:148549042-148549064 CTGGGGCAAAAGATCACTGATGG - Intergenic
940625252 2:156167237-156167259 CTGGAGAAAAAGATGACCGCAGG + Intergenic
940774569 2:157873448-157873470 CTGGAGAAGCAAACCACTGATGG - Intronic
942144784 2:173016247-173016269 CTGGTGAAGCAGATGACATAGGG + Intronic
942877478 2:180818692-180818714 GTGCAAAAACAGATCAAAGAAGG - Intergenic
942967757 2:181917566-181917588 CAGGAGAAAGAGACCACAGCTGG - Intronic
943503853 2:188728479-188728501 ATGGAGAAACACATCCCAAAAGG + Intergenic
945682518 2:212931390-212931412 CTGGGCAAAGAGATCAAAGAGGG - Intergenic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946822809 2:223647612-223647634 CTGAAGAAACTGTTCCCAGATGG - Intergenic
947234793 2:227929512-227929534 CTGTAAAAACAAATCCCAGAAGG - Intergenic
947542727 2:230990117-230990139 ATGGAGAAACTGAACACAGTCGG + Intergenic
947868273 2:233416822-233416844 CTAGAGAAACAAACCACAGCAGG - Intronic
1169194578 20:3676275-3676297 CAGGAGGGCCAGATCACAGAAGG - Intronic
1169341138 20:4797303-4797325 CCATAGAAACAGATAACAGATGG - Intronic
1169580297 20:7015284-7015306 ATGGATACACAGATCACAAATGG - Intergenic
1170837649 20:19898311-19898333 CTGGAGAAATACATCATTGAGGG - Intronic
1171384201 20:24756688-24756710 CAGAAGAATCAGATCACACATGG + Intergenic
1172312235 20:33927621-33927643 ATGAGGAAACAGATCATAGAGGG + Intergenic
1172379461 20:34476028-34476050 ATGGACTAACAGATCACAGTTGG - Intronic
1172641322 20:36442096-36442118 CTGGAGATACAGATTAGGGATGG - Intronic
1173993741 20:47322238-47322260 ATTGAGAAACTGATTACAGATGG + Intronic
1176071801 20:63230807-63230829 CGGAAGAATCAGATCACACATGG + Intergenic
1176083940 20:63287406-63287428 CGGGAGAAACAGATCCCACCTGG + Intronic
1177264492 21:18765186-18765208 CAGAAGAATCAGATCACACATGG - Intergenic
1177740936 21:25153334-25153356 CTGGAGCAACATCTCATAGAGGG - Intergenic
1178297934 21:31426514-31426536 CTTTAGAAACAGACCACAGTTGG - Intronic
1178438686 21:32581354-32581376 CTGAAAAATCAGATCACACATGG - Intronic
1178619027 21:34158343-34158365 CTGGAGAATCAGATTTCAGAGGG + Intergenic
1179246570 21:39638565-39638587 CTGAAGAATCAGATCACATGTGG - Intronic
1180055545 21:45357233-45357255 CTGGAAAATCAACTCACAGAAGG - Intergenic
1180123393 21:45769109-45769131 GTGGAGAAACAAATGAAAGAGGG - Intronic
1180536940 22:16402093-16402115 CTGCTGAAAGAAATCACAGATGG + Intergenic
1181148882 22:20868744-20868766 CTGGAAAGGCAGCTCACAGATGG + Intronic
1182709558 22:32311986-32312008 CTGCAGAAAAAGCTCACAGTGGG - Intergenic
1183087957 22:35498870-35498892 CTGGAGAGGCAGGTCAGAGAGGG - Intergenic
949253402 3:2015573-2015595 TTAGAGAAACAGAGTACAGAAGG - Intergenic
950307183 3:11925060-11925082 CTGGAGAAGCACATCAGAGCCGG - Intergenic
950392381 3:12706782-12706804 CTGGAGAAGCTGTTCTCAGATGG - Intergenic
951064132 3:18244244-18244266 CTTGGGACACATATCACAGAGGG - Intronic
951994511 3:28712704-28712726 CTGGAGAAACCTAATACAGAGGG - Intergenic
952126999 3:30312639-30312661 CTGGACAAAGAGATCCCAGCAGG + Intergenic
952184373 3:30953089-30953111 CTTGACAAACAGAATACAGAAGG - Intergenic
952298770 3:32085567-32085589 CAGAAGAATCAGATCACACATGG + Intergenic
952649643 3:35709904-35709926 CTCCAGAAGCAGATCACAGCAGG - Intronic
952977461 3:38708354-38708376 GTCAAGAAACAGATTACAGAGGG - Intronic
953088398 3:39697543-39697565 CGGAAGAATCAGATCACACATGG - Intergenic
953854617 3:46491682-46491704 TTGGAGAATAAGATCACAGAGGG + Intergenic
955403419 3:58609792-58609814 CTGTAGGAAGAGGTCACAGATGG - Intronic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
957936622 3:86951978-86952000 CTGGAGAAACAGATTAGAGGAGG + Intronic
960484592 3:118236327-118236349 ATTGAGAGACAAATCACAGAAGG + Intergenic
960866304 3:122203081-122203103 CAGAAGAAAAAGAACACAGAAGG - Intronic
961008505 3:123420848-123420870 CTGGGGAAACAGCCCTCAGAAGG - Intronic
961070966 3:123925973-123925995 CTGGAGAAACATATCTTTGAAGG + Intronic
961450725 3:127001216-127001238 GTGAAGAAACGGGTCACAGAAGG - Intronic
961978183 3:131048541-131048563 CTGAAGGTCCAGATCACAGAAGG - Intronic
963120169 3:141769608-141769630 CTGCAGATACAGATCAGAGAAGG - Intergenic
963217929 3:142771999-142772021 CAGTAGAAACAGATGCCAGAAGG - Intronic
963299115 3:143579228-143579250 CTTCAGAAACAGAGCACTGATGG + Intronic
964320971 3:155496977-155496999 CTTGAGGACCAGGTCACAGATGG - Intronic
966266702 3:178054751-178054773 ATTGAGAAACACATCATAGAGGG - Intergenic
966666749 3:182480205-182480227 CTGGAGAAAGAGATGAGATAGGG - Intergenic
967203655 3:187099347-187099369 CTGCTGAAAGAAATCACAGATGG + Intergenic
968007452 3:195253058-195253080 CTGGAGAAGCAAGTCACAAAGGG + Intronic
969169375 4:5347781-5347803 CAGGAGAAAGAGAGCAAAGAGGG - Intronic
970444908 4:16115440-16115462 GTGGAGAATTAGACCACAGAGGG - Intergenic
970737862 4:19195760-19195782 CTGGAGAAATGGAGCACAGGGGG - Intergenic
971907708 4:32748493-32748515 CTGAAGAACCAGATCACAAGTGG - Intergenic
972373789 4:38451078-38451100 CTTTAGAAACAGATAAAAGAAGG + Intergenic
972686428 4:41358148-41358170 CAGGAGAAAGAGAACAAAGAGGG + Intergenic
973919991 4:55674891-55674913 CTGTAGCAGCAGCTCACAGATGG - Intergenic
974631280 4:64492426-64492448 ATGGTTAAACAGATCACAGTGGG - Intergenic
975230376 4:71925120-71925142 CAGGAGAGAGAGATCAAAGAGGG - Intergenic
976725537 4:88212486-88212508 GTGGAGAACAAGATCACTGAAGG - Intronic
977358289 4:95974031-95974053 TTGGAGGAACAGATTACACAGGG - Intergenic
977763923 4:100775469-100775491 CTAGAGAAAAAGGTCACACAAGG - Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
977906941 4:102487921-102487943 CTGCAGAAAGAAATCATAGATGG + Intergenic
978279764 4:106996624-106996646 CTAGCAAAACAGATCACCGAGGG - Intronic
978580674 4:110228541-110228563 ATGGGGAAGCAGATCCCAGATGG + Intergenic
979150407 4:117307071-117307093 CTGATGAAAGAAATCACAGATGG - Intergenic
980427531 4:132645826-132645848 CTGGCCAAGCAGATCACAGGAGG + Intergenic
981298602 4:143161394-143161416 ATGAAGCAACATATCACAGAAGG + Intergenic
982499033 4:156130816-156130838 CCTGAGACACAGATCCCAGAGGG + Intergenic
985723476 5:1502715-1502737 CAGGAGACACAGATCGCAGTTGG + Intronic
988932634 5:36051695-36051717 ATGGAGAGACAGATGACAGGGGG - Intronic
989093639 5:37760092-37760114 ATGGAGAAACACATCACATCAGG - Intergenic
991172373 5:63643537-63643559 CTTGGAAAACAAATCACAGAGGG + Intergenic
991326973 5:65444701-65444723 CAGGAGACAGAGATCACTGAGGG + Intronic
992038195 5:72802540-72802562 CAGAAGAATCAGATCACACACGG - Intergenic
992122829 5:73611964-73611986 GTTAAGAAACAGACCACAGAAGG + Intergenic
992226911 5:74627681-74627703 CTGTAGAAACACATAACAAAGGG - Exonic
993430465 5:87826508-87826530 ATGGAGAAAAAAATCACAGTGGG - Intergenic
993617688 5:90133724-90133746 CTTAAGAAACAGATCAGTGAAGG - Intergenic
994139835 5:96330033-96330055 CTGGAGAAAAAGACAAGAGATGG - Intergenic
995092459 5:108194170-108194192 CTGGGGAAAGAGATCCCAGTTGG - Intronic
995679636 5:114702604-114702626 CTGTGGAAATAGATAACAGAAGG + Intergenic
996337485 5:122400633-122400655 ATGGAGAAGCAGAACACAGCTGG + Intronic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
997117287 5:131138805-131138827 CAGGAGAAAGGGATGACAGATGG - Intergenic
997146613 5:131440972-131440994 CTGGAGATAGAGAGCTCAGATGG - Intronic
999078286 5:148818219-148818241 TGGGAGAAACAGCTCAGAGAAGG - Intergenic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1002721279 5:181262553-181262575 CTGCAGAGACAGAAGACAGAAGG - Intergenic
1003306483 6:4933562-4933584 CTGGAGGAACAGATTAGAGAGGG + Intronic
1003634637 6:7821103-7821125 CTGGAGAAACAGCCCACAACAGG - Intronic
1003805251 6:9720971-9720993 CTGGAGGAACAGTTTCCAGATGG - Intronic
1004349807 6:14881084-14881106 CTGTAGAAAGAGATCCCAGCAGG - Intergenic
1004454253 6:15777041-15777063 CTGAAAAATCAGCTCACAGAAGG + Intergenic
1004653793 6:17638382-17638404 CTGGAGAAACAGATCACAGATGG - Intronic
1006015600 6:31078391-31078413 CTGGAGAAACTGACCAGACAAGG + Intergenic
1006821034 6:36895249-36895271 CTGGAAAATGAGATCACAGCTGG - Intronic
1007941635 6:45786853-45786875 CTGGGGAAACAGCTCTGAGAAGG + Intergenic
1008162057 6:48090579-48090601 CTGGAAAAAAAAATCTCAGAAGG + Intergenic
1008730856 6:54481119-54481141 CAGAAGAATCAGATCACACATGG + Intergenic
1009003769 6:57754051-57754073 CTAGAGAAACAGAAAACTGATGG + Intergenic
1009435914 6:63618492-63618514 CTGGAGAAACAACACACAGCTGG - Intergenic
1010173629 6:73001061-73001083 CTGGAGAAACACATCCTAGAAGG - Intronic
1010742725 6:79527196-79527218 CTGGTAAAACAGACCCCAGAAGG + Intronic
1011370702 6:86633937-86633959 CTGGAGACAGAGCTCCCAGAGGG - Intergenic
1014657963 6:124131612-124131634 CTGAAAATCCAGATCACAGAAGG + Intronic
1015925693 6:138308342-138308364 ATGCAGAAAAAGAGCACAGAAGG - Intronic
1017025848 6:150179872-150179894 TTGGGGAAACAGATAACAAAAGG + Intronic
1017816005 6:158017178-158017200 GGGAAGAAACACATCACAGAAGG - Intronic
1017979046 6:159382689-159382711 CTGGAAAACCAGAAAACAGATGG + Intergenic
1018091528 6:160349653-160349675 ATGCAGAAACAGATTACTGAGGG - Intronic
1018168385 6:161122891-161122913 CTGCTGAAAGAAATCACAGATGG - Intergenic
1018493548 6:164323431-164323453 GTGGAAAAAAAGATCACAAATGG - Intergenic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1021811579 7:24406949-24406971 CTGGACAAAGTGATCACAGGGGG + Intergenic
1021975825 7:26010196-26010218 CTGGAGAGTCACATCACAAAGGG + Intergenic
1022649109 7:32258756-32258778 CTTGAGTAAAAAATCACAGAAGG - Intronic
1022841417 7:34167751-34167773 ATGCAGACACAGATCACAGAAGG + Intergenic
1023634163 7:42193141-42193163 CTAGAGAAACAGCTCAAGGAAGG + Intronic
1024203048 7:47125960-47125982 CAGGAGAATTAGATCACACATGG + Intergenic
1026336666 7:69399542-69399564 CTGGAGGGACAGAAGACAGAGGG - Intergenic
1028172282 7:87612921-87612943 CTGCAGAAAGAAATCATAGATGG - Intronic
1028462327 7:91108548-91108570 CTGAAGGAATAAATCACAGAAGG - Intronic
1029427802 7:100507690-100507712 ATGGAGAAACAAAGGACAGAAGG - Intergenic
1031232321 7:119123724-119123746 CCAGAGAAACAGATCACACATGG - Intergenic
1032194935 7:129782994-129783016 CTCGAGATCGAGATCACAGAGGG - Intergenic
1032806330 7:135358451-135358473 TTGGAGAAACAGACAACACAAGG + Intergenic
1033611303 7:142965522-142965544 ATGGAGAAACAGATCATGGGGGG + Intergenic
1034164581 7:149015591-149015613 CTGGAGAATGAGGCCACAGATGG - Intronic
1034399482 7:150852646-150852668 CAGAAGAAACAGGACACAGAGGG + Intronic
1035172557 7:157026367-157026389 CTGAAGAAAGAAATCAAAGAAGG - Intergenic
1035962042 8:4148082-4148104 CTTGAAAAACATAACACAGATGG + Intronic
1035977348 8:4327006-4327028 TGGGAGAACCAGACCACAGAAGG + Intronic
1036211225 8:6842780-6842802 CTGCAGAGTCAGATCACAAAGGG - Intergenic
1037250208 8:16884257-16884279 GAGGAGAAAGAGATCACAAAGGG + Intergenic
1037688607 8:21164339-21164361 CTTGGGAAACAGATCAAGGAAGG - Intergenic
1037968963 8:23158068-23158090 CTTGAGAAACAGTGCACAGCCGG - Intronic
1038072302 8:24030620-24030642 ATGGAGAAACTGATGACATAGGG + Intergenic
1038862391 8:31401700-31401722 CAGCAGAATCAGATCACACATGG - Intergenic
1040428745 8:47317203-47317225 ATGGAGAAAGGGATGACAGATGG + Intronic
1041082546 8:54227187-54227209 GTGGAGGAAGAGACCACAGAGGG + Intergenic
1041349513 8:56934575-56934597 CTGGAGCAAGAGATGACAAACGG - Intergenic
1041932955 8:63307445-63307467 CAGGAGGAAAAGATCACATAAGG - Intergenic
1041954278 8:63540256-63540278 CTGGAGAACCAGAAAACTGATGG + Intergenic
1042219153 8:66456342-66456364 CTGGTGGGACAGATCACTGATGG + Intronic
1043239997 8:77920984-77921006 TTGGAGATATAGATCACTGAGGG - Intergenic
1043521257 8:81048052-81048074 CTGGTGAATCAGGTTACAGAGGG - Intronic
1044137881 8:88610042-88610064 TCGGAGAAAAAGATCACACAGGG + Intergenic
1046277433 8:111982163-111982185 CAGAAGAATCAGATCACACACGG + Intergenic
1047294574 8:123559543-123559565 CAGGTGAAACAGTTCTCAGAGGG + Intergenic
1047722963 8:127659214-127659236 CTGGAGAAATAGAACCCATAGGG + Intergenic
1047828880 8:128610145-128610167 CTGGAGATAGAAACCACAGATGG - Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048480207 8:134783113-134783135 CTGGAGAAAAAAGTAACAGAAGG - Intergenic
1048790972 8:138103108-138103130 CTCGAGAGAGGGATCACAGAAGG - Intergenic
1049338263 8:142098022-142098044 GTGGATAAGCAGGTCACAGATGG + Intergenic
1049787927 8:144460027-144460049 CTGGAGAATCTGGGCACAGATGG - Intronic
1050640867 9:7666236-7666258 CTAGAGAAGCAGATCCTAGAAGG + Intergenic
1051464765 9:17365252-17365274 CAGGAGGAAAAGAGCACAGAGGG - Intronic
1051521941 9:17999297-17999319 CTGGTGAAGCCTATCACAGAAGG + Intergenic
1052519768 9:29531517-29531539 CTGGAGCAAGAGATAACAGTTGG - Intergenic
1053024823 9:34720707-34720729 ATGGAGAAACAGGGCAGAGATGG - Intergenic
1053032617 9:34794270-34794292 ATGGAAACACAGTTCACAGAAGG + Intergenic
1053041244 9:34874497-34874519 CTGGAGCAACAAATCTCAAATGG - Intergenic
1053503857 9:38622849-38622871 ATGGAGAAACAAGCCACAGACGG - Intergenic
1053615316 9:39759690-39759712 CTGGGGAAACAGAACACATTTGG + Intergenic
1053644529 9:40112754-40112776 ATGGATAAACAGTTTACAGATGG - Intergenic
1053761453 9:41352097-41352119 ATGGATAAACAGTTTACAGATGG + Intergenic
1053873482 9:42518961-42518983 CTGGGGAAACAGAACACATTTGG + Intergenic
1054238204 9:62582701-62582723 CTGGGGAAACAGAACACATTTGG - Intergenic
1054268848 9:62947790-62947812 CTGGGGAAACAGAACACATTTGG - Intergenic
1054331224 9:63757979-63758001 TTGGAGAAACTGATGACAAATGG + Intergenic
1054350225 9:64013642-64013664 ATGGATAAACAGTTTACAGATGG + Intergenic
1054540046 9:66263215-66263237 ATGGATAAACAGTTTACAGATGG + Intergenic
1054552335 9:66617217-66617239 CTGGGGAAACAGAACACATTTGG - Intergenic
1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG + Intronic
1054878221 9:70118724-70118746 CTGGAGAAACAGCACGTAGAAGG + Intronic
1056783233 9:89567592-89567614 TTGGGGAAAGAGATCAAAGAAGG - Intergenic
1057010865 9:91600219-91600241 ATGAAGAAACTGAACACAGAGGG + Intronic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1059418691 9:114177799-114177821 CTGCAGAATCAGAACAGAGAAGG - Intronic
1061080060 9:128364724-128364746 CTGGAGGAACAGTTTGCAGATGG - Intergenic
1061511018 9:131061028-131061050 CTGCAGACACAGATCCCTGAGGG - Exonic
1061608417 9:131729403-131729425 TTGGAGAAACCTTTCACAGATGG - Intronic
1185700294 X:2226491-2226513 TTGGGGAAAAAGATCACAAAGGG - Intronic
1185837737 X:3360874-3360896 CGGAAGAATCAGATCACACATGG + Intergenic
1186289503 X:8081019-8081041 ATGGGGAAGCAGAGCACAGAAGG + Intergenic
1186448615 X:9653519-9653541 GTGGAAAACCAGAACACAGAAGG - Intronic
1189707381 X:43772606-43772628 ATGGAGAATCAGATCAAAGGGGG - Intronic
1189778484 X:44491449-44491471 CAGGAGAAATCTATCACAGATGG + Intergenic
1190296047 X:49028633-49028655 TGGGAGAAACAGATTCCAGAAGG - Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1191634498 X:63361331-63361353 TTGGAGAAAAAGAGCACACAGGG + Intergenic
1192245944 X:69371624-69371646 CTAGAGAACTAGATGACAGATGG - Intergenic
1192331218 X:70176982-70177004 CGGGAGAAACATTGCACAGAAGG - Intergenic
1194751670 X:97692212-97692234 CTAGCGAAAAAGATGACAGAGGG + Intergenic
1195161622 X:102177224-102177246 TTGGAGAAAAAGAGCACACAGGG + Intergenic
1195868167 X:109456097-109456119 CTGTAGAAACAGATCATGAATGG + Intronic
1196152863 X:112393446-112393468 CTGGGGATAAAGATCCCAGAAGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196498701 X:116351800-116351822 CAGGAGAGACAGAGCACACAGGG - Intergenic
1196600300 X:117594047-117594069 CTAGAGAAAAAGAACAAAGAGGG + Intergenic
1198868731 X:141153713-141153735 CTGGAGAAACAGAGCAAATAGGG + Intergenic
1199670958 X:150147917-150147939 CTGGAGAAACAGGGCACAGGAGG - Intergenic
1201151183 Y:11096491-11096513 ATGGATAAACAGTTTACAGATGG + Intergenic
1201238093 Y:11930861-11930883 CAGAAGAATCAGATCACACATGG - Intergenic
1201727778 Y:17172496-17172518 CAGAAGAATCAGATCACAAATGG + Intergenic
1202069053 Y:20971521-20971543 TTGGAGAAAAAGAGCACACAGGG - Intergenic