ID: 1004657757

View in Genome Browser
Species Human (GRCh38)
Location 6:17680847-17680869
Sequence CATCATGGAGAACATCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004657753_1004657757 19 Left 1004657753 6:17680805-17680827 CCTTGTACACTGTTGTTGGTGGG 0: 1
1: 1
2: 3
3: 27
4: 223
Right 1004657757 6:17680847-17680869 CATCATGGAGAACATCATTGAGG 0: 1
1: 0
2: 1
3: 35
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004657757 Original CRISPR CATCATGGAGAACATCATTG AGG Intronic
900270720 1:1786494-1786516 CATCATTGACAACATCAGAGAGG + Exonic
902090964 1:13902931-13902953 TATCATGGGGACCATCATGGAGG - Intergenic
903546782 1:24129201-24129223 AATCTTGCAGAACAACATTGAGG - Intronic
905658837 1:39704665-39704687 TGTCATGGAGAATATCCTTGCGG + Intronic
905862451 1:41360817-41360839 CACCATGAAGAACATGTTTGCGG + Intergenic
906020350 1:42622800-42622822 CACTATGGAGAACATCTTGGGGG - Intronic
907146943 1:52243464-52243486 CAGCATGGACAAAGTCATTGAGG + Intronic
907146950 1:52243538-52243560 CAGCATGGACAAAGTCATTGAGG + Intronic
908455326 1:64298048-64298070 CAACTTGGAGAACATATTTGAGG + Intergenic
911941404 1:104052307-104052329 CCTCATGGAGAACCTCCTTTAGG - Intergenic
912511968 1:110195701-110195723 CATCCTTGAGAACATCGCTGTGG + Exonic
912953666 1:114137551-114137573 CATCCTGGACAACCTCTTTGAGG - Exonic
913132356 1:115852508-115852530 CATTATGGAAAACAGCATAGAGG - Intergenic
913176807 1:116280795-116280817 CACCATGGAGAACAGTATGGAGG - Intergenic
913423390 1:118698707-118698729 CATGATTAAGAAGATCATTGAGG + Intergenic
914854513 1:151341477-151341499 TATCATGGACAACACCTTTGGGG - Exonic
916714358 1:167436898-167436920 CATTATGGAAAACAGTATTGAGG + Intronic
917002877 1:170379646-170379668 CATCATGGAGAACAGTATGGTGG - Intergenic
917824113 1:178798989-178799011 CACCATTGAGAAAATCATTGAGG + Intronic
918629039 1:186693941-186693963 CACCATTAAGAAAATCATTGAGG + Intergenic
918873095 1:190002446-190002468 CACCATGGAGAACAGTATGGAGG - Intergenic
918942010 1:191012656-191012678 CATCATGCAGAAAATCATTAAGG + Intergenic
919044536 1:192434582-192434604 CATTATGGAAAACATTATGGAGG - Intergenic
919755028 1:201061338-201061360 CTTCATGATGAACATCTTTGTGG - Exonic
920083705 1:203398022-203398044 CATCATGGAAAACAGTATGGAGG - Intergenic
921806550 1:219461916-219461938 AATCAAGGAGAACCTCATGGAGG - Intergenic
921977204 1:221216048-221216070 AATCAGGGAGAACTTCAGTGTGG - Intergenic
922888971 1:229046054-229046076 CCTCATGGAGAACATCTTTCTGG + Intergenic
923443732 1:234048341-234048363 CATCATGGATAACCTCTTTATGG - Intronic
924458910 1:244240745-244240767 CATCTTGGGGAACATCTTTCAGG - Intergenic
924618494 1:245637087-245637109 CATCATGGAAAACATTCTGGAGG - Intronic
924700754 1:246449650-246449672 CTTCATGGAGAACATCAGTGAGG - Intronic
1063261385 10:4393090-4393112 AAGCATGGAGAACACCAATGAGG - Intergenic
1063611660 10:7568019-7568041 CATCATTATGAACATCACTGGGG + Intronic
1065295553 10:24271022-24271044 CATTATGGAGAAAATGATTGAGG + Intronic
1067196674 10:44125944-44125966 CCTCCAGGAGAACATCTTTGGGG - Intergenic
1067255647 10:44636259-44636281 CATTATTAAGAAAATCATTGAGG - Intergenic
1067732554 10:48822516-48822538 CATCCTGGAGCACATCATGGTGG + Exonic
1068112055 10:52691424-52691446 GATCATGGAAGACATCCTTGAGG + Intergenic
1071014157 10:80974955-80974977 CATCATTAAGAAAATCATTAAGG - Intergenic
1071327803 10:84534282-84534304 CCTCATGGAGAACCTCTGTGAGG + Intergenic
1072092121 10:92138769-92138791 CACTATGGAGAACAGCATGGAGG + Intronic
1072678353 10:97485896-97485918 CATTATGGAAAACAGCATGGAGG + Intronic
1074565149 10:114570927-114570949 CATCATGGAAAACAGCATGGAGG - Intronic
1075486404 10:122825175-122825197 CAGCATGAAGAAAATCAGTGAGG - Intergenic
1075988888 10:126815738-126815760 CATTATGGAGAACAGTATGGAGG + Intergenic
1079474086 11:20809932-20809954 CATCATGGAAAACAGTATGGAGG - Intronic
1080117472 11:28636965-28636987 CATCATAGTGTACATCTTTGTGG + Intergenic
1080665059 11:34328620-34328642 CATCATGGAGAACAAAAAGGTGG - Intronic
1081405709 11:42695000-42695022 CATTACGGAGAACAGCATGGAGG + Intergenic
1082678650 11:56142036-56142058 GATAATGGAGAACATCCTTTTGG - Intergenic
1082808278 11:57463538-57463560 CATCATAGGTAACACCATTGAGG - Intronic
1083982846 11:66187878-66187900 CACTATGGAGAACAGCATGGAGG - Intronic
1085871987 11:80361027-80361049 CACCATGAAGAAAATCATTGAGG - Intergenic
1085961980 11:81471352-81471374 CAGCATGGAGATCACCAATGTGG + Intergenic
1086342147 11:85857541-85857563 CTTCAAGGAGACCATGATTGGGG + Intronic
1087410744 11:97787422-97787444 CATAATAGAGTACATCATTTTGG + Intergenic
1087844926 11:102962091-102962113 CGTGATGGAGAACATAGTTGGGG + Intergenic
1088159361 11:106850911-106850933 CATTATGGAAAACATCATGGAGG - Intronic
1091650915 12:2308912-2308934 CATTATGGAAAACAACATGGAGG + Intronic
1091686730 12:2567696-2567718 CATCCTGGAGACCATCCTGGTGG + Exonic
1091997926 12:5009884-5009906 CAGAATGGAGAACAGCATTGGGG - Intergenic
1093130615 12:15387527-15387549 CATCAAGGAGGACTTCACTGAGG - Intronic
1093360092 12:18214782-18214804 CATTATGGAAAACATTATGGAGG + Intronic
1095352360 12:41229041-41229063 CATCATGCAGAATTTGATTGAGG - Intronic
1096554253 12:52393631-52393653 CATCCTAGAGAAAATCCTTGGGG - Intergenic
1098327334 12:69316328-69316350 CTTCATGGAGAACCTCTGTGAGG - Intergenic
1098761865 12:74435020-74435042 CCTCATGGAGAACCTCTGTGAGG + Intergenic
1099701425 12:86087234-86087256 CACTATGGAGAACAGTATTGAGG - Intronic
1099840719 12:87962279-87962301 CATTATGGAAAACATTATGGAGG - Intergenic
1100467338 12:94857982-94858004 CATCATGGGGAAAACCACTGGGG + Intergenic
1101716390 12:107317025-107317047 CATTATGGAAAACAGCATGGAGG - Intergenic
1104331862 12:127854465-127854487 CATTATGGAGAACAGTATGGAGG + Intergenic
1104958559 12:132477469-132477491 CATCTTGGTGATCATGATTGGGG - Intergenic
1106044337 13:26123872-26123894 CATCATTTAGGTCATCATTGAGG + Intergenic
1106626848 13:31429412-31429434 CATCATGGAAAACAGTATAGAGG - Intergenic
1106818001 13:33430495-33430517 CACTATGGAGAACAGCATGGAGG + Intergenic
1107105347 13:36636902-36636924 CCTCATGGAGAACTTCTATGAGG - Intergenic
1107136107 13:36945581-36945603 CACCATTAAGAAAATCATTGAGG - Intergenic
1109220042 13:59632261-59632283 CTTCATGGAGAACTTATTTGAGG - Intergenic
1109651620 13:65335595-65335617 CATCATGCAAATCATCACTGAGG + Intergenic
1109742492 13:66573003-66573025 CATTATGGAAAACAGTATTGGGG - Intronic
1109814956 13:67569378-67569400 CATCACACAGAACATCATTCTGG - Intergenic
1110042986 13:70788797-70788819 CATTATGGAAAACAACATGGAGG + Intergenic
1110742643 13:79016070-79016092 CAACATGGAAAACATATTTGAGG - Intergenic
1112479546 13:99761738-99761760 CACTATGGAGAACAGTATTGAGG - Intronic
1112706997 13:102081518-102081540 AATGATAGAGAATATCATTGGGG - Intronic
1115924967 14:38422425-38422447 CATCATGGAGAACAGTTTGGAGG - Intergenic
1116026427 14:39521105-39521127 CATTATGGAGAACATTATGGAGG - Intergenic
1116129607 14:40838203-40838225 CATCATTAAGAAAATCACTGAGG + Intergenic
1116222679 14:42109575-42109597 CAACCTGGAAAACATAATTGAGG - Intergenic
1116413440 14:44651769-44651791 CACTATGGAGAACAGCATGGAGG + Intergenic
1116810188 14:49532388-49532410 CATTATGGAGAACAGTATGGGGG + Intergenic
1117614740 14:57522089-57522111 CATCATGGAAAACAGTATGGAGG - Intergenic
1118146769 14:63145780-63145802 CATTATGGAGAACAATATGGAGG - Intergenic
1120921054 14:89755745-89755767 CCTCATGGAGAACCTCTGTGAGG - Intergenic
1121439388 14:93939264-93939286 CTTCATGGCGAACATGATGGTGG + Exonic
1121784209 14:96642987-96643009 CATTATGGAAAACAGTATTGAGG - Intergenic
1121920937 14:97880802-97880824 CATTATGGAGAACAGTATGGAGG + Intergenic
1123095815 14:105766568-105766590 CATCATGGAGGACAGCATCAGGG + Intergenic
1126331341 15:47534976-47534998 CATAATGTAGAACAGCTTTGGGG + Intronic
1126965963 15:54054192-54054214 CATCATGGAGAACAGTTTGGAGG - Intronic
1128445579 15:67757115-67757137 CATTATGGAAAACAGCATGGAGG - Intronic
1129342631 15:74896165-74896187 CAACATGGAGGACATCTTTGGGG + Exonic
1131468116 15:92672203-92672225 CACCAGGGAAAAGATCATTGAGG - Intronic
1131661127 15:94518288-94518310 CATTATGGAGAACAGTATGGAGG + Intergenic
1131769207 15:95716574-95716596 CAGCATGAAGAATGTCATTGTGG + Intergenic
1132037262 15:98495091-98495113 CATTATGGAGAACAGTATGGGGG - Intronic
1137013706 16:35350870-35350892 CATTAGGGAAAACATCATGGAGG - Intergenic
1137408018 16:48205435-48205457 CATCAGGGAGAACATCCTCATGG - Exonic
1137678751 16:50319899-50319921 CGTCATGGAAAACAACTTTGTGG - Exonic
1137693185 16:50443741-50443763 CATCATGGAAAACTGCATGGAGG + Intergenic
1137880511 16:52041648-52041670 CATCATGGAAAACAGGATGGAGG - Intronic
1138758179 16:59514185-59514207 CACCATTAAGAAAATCATTGAGG - Intergenic
1139649164 16:68353545-68353567 CATCATGGACGACATGATTAAGG + Exonic
1140901867 16:79375340-79375362 CATGATGAAGAACAACAATGTGG - Intergenic
1141076590 16:81011239-81011261 CATCATAGAGAACATGACTTGGG - Intronic
1143801285 17:9384026-9384048 TATGATGGAGAACAGCATGGGGG - Intronic
1146888597 17:36489363-36489385 CATTATGGAAAACAGCATAGAGG - Intronic
1147126499 17:38373340-38373362 CACCATGGGGAAAATCACTGAGG + Intronic
1148845241 17:50526150-50526172 CATCATGGAGGAGATCCTGGTGG + Exonic
1149033884 17:52113450-52113472 CACCATGGAGAAATTCAATGTGG + Intronic
1149967085 17:61175632-61175654 CATTATGGAAAACAGTATTGAGG - Intronic
1150198498 17:63327294-63327316 CATTATGGAAAACAGCATGGAGG + Intronic
1150283256 17:63941472-63941494 CATCCTGGAGAACTTCAATGTGG - Exonic
1150514888 17:65797894-65797916 CTTCATGTAGAGTATCATTGTGG + Intronic
1150535536 17:66035516-66035538 CATTATGGAGAACAGTATGGAGG + Intronic
1152987854 18:335855-335877 CACCATGAAGGACATCAGTGGGG - Intronic
1153113910 18:1631049-1631071 CATCATGGAGAACTATATGGAGG + Intergenic
1153338674 18:3951709-3951731 TATCATGGAGAACAGCATGGGGG - Intronic
1153448635 18:5200628-5200650 TATTATTGAGAACCTCATTGTGG - Intergenic
1153480062 18:5538713-5538735 TGTCATGGAGGACATCAGTGTGG - Intronic
1153875616 18:9368033-9368055 CATTATGGAGAACAGTATGGAGG - Intronic
1154433258 18:14324601-14324623 GATCATGGAGAAAATTATTATGG + Intergenic
1155018974 18:21877130-21877152 CATTATGGAGAACAGTATAGAGG + Intergenic
1155510753 18:26574098-26574120 CAAGATGGAGAAAATCATAGTGG - Intronic
1155662878 18:28272857-28272879 CATTATGGAGAACAACATGAAGG + Intergenic
1155789116 18:29942593-29942615 CACGATGGAGAACATTATGGGGG - Intergenic
1156344908 18:36248021-36248043 CATCATGGAAAACACTACTGAGG - Intronic
1157917801 18:51685443-51685465 CATCATTGACAACATGATTATGG + Intergenic
1159933546 18:74340426-74340448 CATCATGGAAAACACTATGGAGG + Intronic
1161683773 19:5693297-5693319 CATCAAGGAGAAGACCATTGCGG - Exonic
1162610684 19:11748511-11748533 CACTATGGAGAACATTTTTGAGG - Intergenic
1162700588 19:12512101-12512123 GATCATTGAGCACTTCATTGAGG - Intronic
1165537143 19:36458033-36458055 CATTATGGAAAACAGCATGGAGG + Intronic
1165986993 19:39778104-39778126 CATCATGGAGAAGAACGTTAGGG + Intronic
1166023271 19:40053481-40053503 CATTATGGAAAACAGCATGGAGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1168628650 19:57939311-57939333 CATTATGGAGAACAGTATTGAGG + Intergenic
926244810 2:11114948-11114970 CATTATGGAGAACAGTATGGAGG + Intergenic
926648205 2:15312941-15312963 CATCAGGTAGAGCAGCATTGGGG - Intronic
927940391 2:27099773-27099795 CACCATGGAGACTACCATTGCGG + Exonic
927948857 2:27154088-27154110 CCTCATGGAGATCGTCCTTGGGG + Exonic
928981583 2:37141219-37141241 CATCATTGAGGACATGATGGTGG - Intronic
929660465 2:43779296-43779318 CTTCATGGAGAACATTATTTTGG + Intronic
931113054 2:59134199-59134221 CACCATGAAGAATACCATTGTGG - Intergenic
931186398 2:59955912-59955934 CATTATGGAGAACAGTATGGAGG + Intergenic
932471172 2:71959841-71959863 CAGCAGGGAGAACATCAGTAAGG - Intergenic
936940656 2:117880866-117880888 CATTATGGAGAACAGTATGGAGG - Intergenic
937069106 2:119049232-119049254 AATCTTGGAGAACATATTTGGGG - Intergenic
937444568 2:121946796-121946818 CATTATGGAGAACACTATGGAGG - Intergenic
938201698 2:129377586-129377608 CTATATGGAGAACATCACTGCGG + Intergenic
938556979 2:132434073-132434095 CACCATTAAGAAAATCATTGAGG + Intronic
939717803 2:145607078-145607100 CATCAAGCAGGACCTCATTGAGG + Intergenic
940446167 2:153780383-153780405 GATTACGGAGAACAGCATTGAGG - Intergenic
940832540 2:158483543-158483565 CATCATAGAGACCATCAGTGTGG + Intronic
942310341 2:174650576-174650598 CATCATGGAGAAGAACAGTCAGG - Intronic
942661544 2:178270156-178270178 CACCATGGAGAACAGCAATCAGG + Intronic
943328599 2:186531808-186531830 AAGCAAGGAGAACATCATTTTGG - Intergenic
944159923 2:196648208-196648230 CATTTTGGAGAACAGCATGGAGG - Intronic
944371175 2:198985450-198985472 CCTCATGGAGAACCTCACTAGGG - Intergenic
944428846 2:199611845-199611867 CATCATGGAGGAAGTCACTGAGG - Intergenic
945144678 2:206725291-206725313 CATTATGGAAAACAACATGGAGG - Intergenic
1171089300 20:22268949-22268971 CATTATGGAAAACAGCATAGAGG - Intergenic
1173779010 20:45737665-45737687 CATTATGGACAACATTATAGAGG + Intergenic
1173926566 20:46785392-46785414 CATCAGGGAGAGCATCTCTGAGG - Intergenic
1174293932 20:49530495-49530517 CATCATGGAGAACAGTATGGAGG - Intronic
1174680789 20:52406147-52406169 CATCATGGAGAACAGTAAAGAGG - Intergenic
1175492453 20:59388447-59388469 CATCATGGGGAGCATCATCTGGG + Intergenic
1175560079 20:59917267-59917289 CATCATTTAGAACTTCATTGGGG - Intronic
1177063734 21:16403259-16403281 CACCATTAAGAAAATCATTGAGG - Intergenic
1177450616 21:21260256-21260278 CAACATGGAAAACATAATTGAGG + Intronic
1180986921 22:19910415-19910437 CATCAGGGAGAACATTAAGGAGG - Intronic
950931980 3:16799126-16799148 CATTATGGAGGAGATCATTCTGG + Intergenic
951636542 3:24784701-24784723 CCTCATTGAGATCATCATAGGGG + Intergenic
951910362 3:27743875-27743897 CAGCAGGTAGAACAGCATTGAGG + Intergenic
952387409 3:32852243-32852265 CATCCTGGAGAAGGACATTGAGG + Intronic
952571200 3:34719504-34719526 CACCATGAAGAAAATGATTGAGG + Intergenic
952592903 3:34979081-34979103 CATTATGGAGAACAGTATGGAGG + Intergenic
952805698 3:37349356-37349378 GATCAAGGAGAACATCATGGAGG + Intronic
952954937 3:38551040-38551062 CATCCTGGAGAACTTCAGCGTGG - Exonic
952961899 3:38597577-38597599 CATCATAGAGGACATCTTGGAGG - Intronic
954868484 3:53749376-53749398 CTTCATGATGAACATCTTTGTGG + Exonic
956432736 3:69204067-69204089 TATCATGGAGGACATAAATGGGG + Intronic
956438713 3:69259517-69259539 CAACATGGCGAACATTAGTGTGG - Intronic
956855055 3:73267956-73267978 CATTATGGAGAACAGTATTGAGG - Intergenic
957124558 3:76142237-76142259 CATTATGGAGAACAGTATGGAGG + Intronic
957348836 3:78996907-78996929 CATCTGGCAGAACAACATTGAGG - Intronic
957573393 3:81977955-81977977 CATCATTAAGAAAATCACTGAGG - Intergenic
957574936 3:81995369-81995391 CATTATGGAAAACATTATGGAGG - Intergenic
957797825 3:85034663-85034685 CATTATGGAGAACAGTATGGAGG - Intronic
957818248 3:85331690-85331712 CATTATGGAGAACAGTATGGAGG - Intronic
959127951 3:102313889-102313911 CACCATGGAGAACAGCATGCAGG + Intronic
961271634 3:125694098-125694120 TATCAGGAAGAACATCACTGGGG - Intergenic
962078962 3:132116810-132116832 CAACATGGAAAACATATTTGAGG - Intronic
962138080 3:132758677-132758699 CATCAGGGAGGAGATCATGGAGG - Intergenic
963489729 3:145984495-145984517 CAACATGGAAAACATATTTGAGG + Intergenic
964757598 3:160102701-160102723 CGTCATGGAAAACAACTTTGTGG + Intergenic
964912825 3:161802634-161802656 CAACAGGGAAAAGATCATTGAGG + Intergenic
966069495 3:175858040-175858062 CACCATGGAGAACAGTATAGAGG + Intergenic
966314797 3:178633310-178633332 CCTCATGGAGAACCTCCGTGAGG - Intronic
966456724 3:180126244-180126266 CATCATTAAGAAAATCATTAAGG + Intergenic
966977594 3:185099136-185099158 CAACATGGAAAACATAATTCAGG + Intronic
969305956 4:6326450-6326472 GATCAAGGAGAACTTCATGGAGG + Intronic
970678254 4:18477247-18477269 CCTCATGGAGAACATCTGTTAGG - Intergenic
970756288 4:19430172-19430194 CTGAATAGAGAACATCATTGAGG + Intergenic
971601378 4:28596025-28596047 CCTCATGGAGAACCTCTTTTAGG + Intergenic
971705187 4:30032594-30032616 AATAATGAAGAACAACATTGTGG - Intergenic
972523152 4:39881370-39881392 CATTATGGAGAACAGTATGGAGG - Intronic
973114525 4:46438764-46438786 TATAATGGAGAACAACTTTGTGG - Intronic
974544767 4:63287335-63287357 CATTATGGAAAACAGCATGGAGG - Intergenic
974926982 4:68311309-68311331 CATTATGGAGGAAATCATTATGG + Exonic
975428445 4:74258150-74258172 CATCATGGAAAACAGTATGGAGG + Intronic
976571736 4:86619777-86619799 CATCATGGAGACAAGTATTGGGG - Intronic
977419568 4:96781121-96781143 CATTATGGAAAACATTATGGAGG + Intergenic
978095855 4:104776430-104776452 CATCATGGAAAACATTATGGAGG - Intergenic
978244558 4:106557379-106557401 CACCATGGAGAACAGTATGGAGG + Intergenic
979703604 4:123694784-123694806 TATCATTGAGAACAGCATGGGGG + Intergenic
980547509 4:134287215-134287237 CATTATGGAAAACATTATGGAGG + Intergenic
980752600 4:137111500-137111522 CATTATGGACAACAGCATTGAGG - Intergenic
980808140 4:137839905-137839927 CATTATGGAGAACAGTATTGAGG + Intergenic
980891942 4:138824924-138824946 CTTCATGGAGGACCTCATTAGGG - Intergenic
980986243 4:139697375-139697397 CACCATTAAGAAAATCATTGAGG - Intronic
981391553 4:144197010-144197032 CCTCATGGAGAACCTCTTTTAGG + Intergenic
982480821 4:155908038-155908060 CATCATTTATAACATCTTTGTGG - Intronic
983159827 4:164398724-164398746 CATTATGGAAAACTTCATGGAGG - Intergenic
983796619 4:171871949-171871971 GTTCATGGACAACATCATTGTGG - Intronic
984074915 4:175164337-175164359 CATCATAAAGAAAATCATTGAGG - Intergenic
984481329 4:180306660-180306682 CATGGTGGAGAACAACATTGGGG - Intergenic
986480254 5:8179749-8179771 CCTCATGGTTAACATCATTCTGG + Intergenic
987477333 5:18407483-18407505 CACCATGGAAAACAGAATTGAGG + Intergenic
988236303 5:28550260-28550282 TATCGTGGAGAACAGCATGGGGG + Intergenic
988304956 5:29482132-29482154 CATCCTGGAAAACATATTTGAGG + Intergenic
988700053 5:33664718-33664740 CATTATGGAAAACAGCATGGAGG + Intronic
989778100 5:45233050-45233072 CATCATGGAGAACCTCTTCTAGG - Intergenic
990783081 5:59388410-59388432 CATTATGGAAAACAGCATCGAGG + Intronic
991317967 5:65332662-65332684 CATCATAGATAACAAAATTGAGG + Intronic
992986936 5:82240091-82240113 CACTATGGAGAACAATATTGAGG + Intronic
993268773 5:85765377-85765399 CACTATGGAGAACATCTTGGAGG - Intergenic
993923003 5:93830572-93830594 CAGCAGGGAGAACCTCACTGAGG - Intronic
994433783 5:99702561-99702583 AATCATGGAGAAAAAAATTGAGG - Intergenic
994872992 5:105378022-105378044 CAACATGGAAAACATATTTGAGG - Intergenic
995213183 5:109564250-109564272 CACTATGGAGAACAGCATGGGGG - Intergenic
995830674 5:116351635-116351657 CATCATTAAGAAAATCACTGAGG - Intronic
997108226 5:131045828-131045850 CATCATGGAGAACCTCTGTTAGG - Intergenic
997743773 5:136280477-136280499 AATCATGGAGAAAATCTTAGGGG - Intronic
998379899 5:141716823-141716845 CAGCAGGAAGAACATCATTTTGG + Intergenic
999650402 5:153761587-153761609 CATCATGGACAGCATTATGGAGG + Intronic
1000249895 5:159483910-159483932 CACCAAGGAGAACATCTTTGTGG - Intergenic
1001739804 5:174043355-174043377 CATCATGAAGAACAGTATGGAGG - Intergenic
1001944414 5:175766859-175766881 CCTCATGGAGAACCTCTATGAGG - Intergenic
1002365343 5:178705480-178705502 CATCAGGGAGTACATCTTGGAGG - Intergenic
1002977296 6:2093986-2094008 TGTCATGAAGAACTTCATTGAGG - Intronic
1003001898 6:2343647-2343669 CACTATGGAGAACAGCATGGAGG + Intergenic
1003295529 6:4823224-4823246 CATCATGGATAAGATCAATTAGG - Intronic
1003775630 6:9359549-9359571 CACCCTGGAGAACAGCATGGAGG + Intergenic
1004657757 6:17680847-17680869 CATCATGGAGAACATCATTGAGG + Intronic
1004882124 6:20019689-20019711 CATCTTGGAGAACAGTATGGAGG + Intergenic
1006207455 6:32360618-32360640 CATTATGGAAAACAGTATTGTGG - Intronic
1006233182 6:32603077-32603099 CATCACTGAGAACATGATTTGGG + Intergenic
1007211965 6:40199992-40200014 CATTATGGAAAACAGCATGGAGG - Intergenic
1008094566 6:47326496-47326518 CATTATGGAAAACAGCATGGAGG + Intergenic
1008146365 6:47896426-47896448 CTTCATGGAAAACAGCAATGTGG - Intronic
1008444455 6:51571901-51571923 CATCATGCAGCACATCACAGTGG + Intergenic
1008447239 6:51606725-51606747 CACTATGGAGAACCGCATTGAGG + Intergenic
1009558343 6:65204131-65204153 CATAATTGAGAAAATAATTGAGG + Intronic
1009670677 6:66745323-66745345 CATTATGGAAAACAGCATGGGGG - Intergenic
1009955694 6:70449831-70449853 CATTATGGAAAACATTATAGAGG - Intronic
1010630739 6:78194597-78194619 CATTATGGAGAACAGCTTAGAGG - Intergenic
1010690580 6:78907093-78907115 CATCATGGAAGACATCACTGTGG - Intronic
1011093802 6:83636247-83636269 CAACTTGGAGAACATATTTGAGG - Intronic
1011272123 6:85590500-85590522 CACCATTCAGAAAATCATTGAGG - Intronic
1012368704 6:98476306-98476328 CATTATGGAAAACATTATGGAGG + Intergenic
1012486533 6:99727967-99727989 CATTATGGAAAACATTATGGAGG - Intergenic
1013210412 6:107982097-107982119 CATCATGGAGAATCTTAGTGTGG - Intergenic
1013688579 6:112613912-112613934 CATTATGGAAAACAATATTGGGG - Intergenic
1013839412 6:114372468-114372490 CAGCCTGGAGACCATCACTGTGG - Intergenic
1014186367 6:118438950-118438972 CACCATGGAGAACAGTTTTGAGG - Intergenic
1014503161 6:122219096-122219118 CATCATAGAGAAAGTCATTTAGG - Intergenic
1014668721 6:124272546-124272568 CATCATGGAGAACTTCTGTTAGG + Intronic
1014696541 6:124628400-124628422 CATAATGAAGACAATCATTGTGG - Intronic
1014838715 6:126191006-126191028 CATCATGGAAAACAGTATGGAGG - Intergenic
1015907677 6:138134523-138134545 CACTATGGAGAACATCTTGGAGG + Intergenic
1015909307 6:138151740-138151762 CATTATGGAAAACAACATAGAGG - Intergenic
1016506516 6:144786779-144786801 CATCAAGTACAAGATCATTGTGG - Intronic
1016518275 6:144921606-144921628 CATCATGGAGCACGTCATATGGG - Intergenic
1017263620 6:152416691-152416713 CATTTTGAAGAGCATCATTGAGG + Exonic
1018034484 6:159870029-159870051 CATTATGGAAAACAGTATTGAGG - Intergenic
1018413321 6:163578739-163578761 CCTCATCCAGAACATCATTCAGG + Intergenic
1018517443 6:164601314-164601336 CTCCATGGAGAACCTCTTTGGGG - Intergenic
1019096755 6:169587518-169587540 CATCATTAAGGAAATCATTGAGG - Intronic
1019971569 7:4545466-4545488 CACCATGGAGAACAGAATGGAGG - Intergenic
1020195117 7:6031846-6031868 CCACATGGAGATCATCACTGTGG - Intronic
1020790111 7:12616802-12616824 CATCATAGACAACACAATTGTGG + Intronic
1020826861 7:13039577-13039599 CATCATGGAGATCTTCCTTTTGG - Intergenic
1021608933 7:22437673-22437695 CATCATGGAAAACTGCATAGAGG - Intronic
1023522286 7:41060511-41060533 GAGGATGAAGAACATCATTGAGG - Intergenic
1024931784 7:54672014-54672036 GATCCTGGAGAACGTGATTGTGG + Intergenic
1025973085 7:66346397-66346419 CACCATGGAGAACAGTATGGAGG - Intronic
1026542565 7:71293273-71293295 CATCATGGAAAACAGTATAGTGG - Intronic
1027442949 7:78239828-78239850 CATTATGGAAAACAGCATGGAGG + Intronic
1028169367 7:87577479-87577501 CATGATGGAGAACAGTATGGGGG - Intronic
1030660948 7:112219036-112219058 CATTATGGAAAACAGCATGGAGG - Intronic
1031380063 7:121074578-121074600 CACCATTAAGAAAATCATTGAGG - Intronic
1033066807 7:138163806-138163828 AATCATTGAGAACCTCATTGAGG - Intergenic
1033813740 7:145048020-145048042 CACCATGGAGAACAGTATAGAGG - Intergenic
1033910718 7:146260252-146260274 CCTCATGGAGAACCTCAATTAGG + Intronic
1035063219 7:156084817-156084839 CATAATGGAGAACAGTATGGAGG - Intergenic
1037523722 8:19704496-19704518 CATTATGGAAAACAGTATTGAGG + Intronic
1038009129 8:23459955-23459977 CATCAGGGAGAGCTTCTTTGAGG + Intergenic
1038293726 8:26272221-26272243 CATCAAAGAGACCATCCTTGGGG - Intergenic
1039311278 8:36321028-36321050 CAACATGGATAAGATCATGGGGG - Intergenic
1039657569 8:39426624-39426646 CATCATGCAGGACATCTGTGTGG + Intergenic
1039794307 8:40898911-40898933 CACTATGGAGAACAGTATTGGGG + Intergenic
1040486078 8:47873110-47873132 CAGTATGGAGAACAGCATGGAGG + Intronic
1041579465 8:59441126-59441148 CACCATGGAGAACATATTGGAGG - Intergenic
1041758703 8:61340753-61340775 CATCATGGAAAACAATATGGAGG - Intronic
1042740731 8:72042485-72042507 CATTATGGAAAACAGTATTGGGG + Intronic
1042948869 8:74180560-74180582 CACCATGAACAACATCAGTGTGG - Intergenic
1043386502 8:79753412-79753434 CATTATGGAGAACAATATGGAGG + Intergenic
1043696137 8:83220550-83220572 CAGCATGGAAAACATATTTGAGG - Intergenic
1043952179 8:86321553-86321575 TATCATGGATGTCATCATTGTGG - Intergenic
1045441189 8:102213237-102213259 CATCATGAAGAACATGACTATGG + Intronic
1045521668 8:102908443-102908465 CATTATGGAGAACAATATGGAGG + Intronic
1045785771 8:105918696-105918718 CCTCATGGAGAACATCTGCGAGG + Intergenic
1045836375 8:106526353-106526375 CATGAAGGAGAAAATGATTGAGG + Intronic
1046796137 8:118374550-118374572 CATTATGGAAAACAGTATTGAGG - Intronic
1047607937 8:126493212-126493234 CAGCATAGAGAACTTCAGTGTGG + Intergenic
1047731095 8:127729117-127729139 CATAATGGAGAACCTCATTTTGG + Intergenic
1048417978 8:134248405-134248427 CATTATGGAGAACAGTATGGAGG + Intergenic
1048526053 8:135203938-135203960 CAGCCTTGACAACATCATTGTGG - Intergenic
1049517118 8:143066124-143066146 CATCATTGGAAACATCATGGAGG - Intergenic
1050682363 9:8127208-8127230 CATTATGGAAAACAGCATAGAGG - Intergenic
1050910539 9:11063865-11063887 CATCAAAGTGAACATTATTGGGG - Intergenic
1051106264 9:13584394-13584416 CATCATGGAAAACAGTATGGAGG - Intergenic
1051373853 9:16383922-16383944 CATTATGGAGAACAGTATGGAGG - Intergenic
1051591584 9:18781225-18781247 CATCATCCAGGACATCGTTGTGG + Intronic
1051743880 9:20276661-20276683 CCTCATGGAGAACATCTGTTAGG - Intergenic
1051961075 9:22763343-22763365 CATAATGGAAAACATTATGGAGG + Intergenic
1053036039 9:34827386-34827408 CATCCTGGAGACCATCCATGGGG + Intergenic
1053578251 9:39375171-39375193 CATCATGGAAAATAGCATGGAGG - Intergenic
1053842781 9:42203219-42203241 CATCATGGAAAATAGCATGGAGG - Intergenic
1054099834 9:60933982-60934004 CATCATGGAAAATAGCATGGAGG - Intergenic
1054121233 9:61209605-61209627 CATCATGGAAAATAGCATGGAGG - Intergenic
1054586507 9:66972903-66972925 CATCATGGAAAATAGCATGGAGG + Intergenic
1054827583 9:69588684-69588706 CATAATCGTGATCATCATTGTGG - Intronic
1057860998 9:98640713-98640735 CATCTTGGAGGACTTCATGGAGG + Intronic
1057889589 9:98859114-98859136 CATTATGGAAAACATCATGGAGG - Intergenic
1058168215 9:101645590-101645612 CACTATGGAAAACATTATTGGGG - Intronic
1059786874 9:117596074-117596096 TAACAGGGAGAACATTATTGAGG + Intergenic
1061638761 9:131934631-131934653 CACCATGGAGAACAGTTTTGAGG + Intronic
1062239888 9:135531268-135531290 CATCTGGGAGCACACCATTGGGG + Intergenic
1185845418 X:3433220-3433242 CATCAGTGATAACATCTTTGAGG + Intergenic
1186389387 X:9143610-9143632 CAGCATGGAGAAGACCATTCTGG + Intronic
1186985272 X:15006523-15006545 CATTATGGAAAACAGCATGGAGG + Intergenic
1187121525 X:16412246-16412268 CACCTTTGAGAAAATCATTGAGG + Intergenic
1187171292 X:16854718-16854740 TTTCAAGGAGCACATCATTGGGG - Intronic
1187609443 X:20925528-20925550 AATAATGGAGAACAACATTTTGG + Intergenic
1188116866 X:26254918-26254940 CATTATGGAAAACAACATGGAGG - Intergenic
1188232786 X:27686156-27686178 CATCATGAAAAACAGCATGGTGG + Intronic
1188531794 X:31149429-31149451 AATCATGGAGAAGATCAAAGGGG - Intronic
1188979058 X:36709902-36709924 CATCAAGAAGAACATGAGTGGGG + Intergenic
1190921084 X:54853122-54853144 CATTATGGAAAACAGCATTGAGG - Intergenic
1191968238 X:66784922-66784944 CATTATGGAAAACAGCATGGAGG + Intergenic
1192381685 X:70623553-70623575 TATCATAGATAACATTATTGAGG + Intronic
1192711367 X:73593492-73593514 CAACATGGAAAACATATTTGAGG - Intronic
1193072953 X:77325897-77325919 CATTATGGAAAACAGCATGGAGG + Intergenic
1193344884 X:80394125-80394147 CATTATGGAAAACAGTATTGAGG - Intronic
1193550600 X:82888046-82888068 CATTATGGAGAACAGTATTAAGG + Intergenic
1194199886 X:90941540-90941562 CCTCATGGAGAACATCTGTTAGG - Intergenic
1194511191 X:94796924-94796946 CATTATGGAAAACATTATGGAGG - Intergenic
1195029815 X:100915465-100915487 CATTATGGAAAACAGCATGGAGG + Intronic
1195501525 X:105606472-105606494 CATTATGGAGAACAGTATGGAGG + Intronic
1196361174 X:114861562-114861584 CATCATGGAAAACAGTATGGAGG - Intronic
1199343198 X:146707011-146707033 CATCCTGGAGAACATACTTAAGG - Intergenic
1200120303 X:153787068-153787090 CACCTTCGAGAACATGATTGTGG - Exonic
1200230413 X:154441150-154441172 CATCATGGAGAACGGCAAGGTGG + Exonic
1200860573 Y:7987635-7987657 CAGTAAGGAGAACATTATTGGGG - Intergenic