ID: 1004660732

View in Genome Browser
Species Human (GRCh38)
Location 6:17706829-17706851
Sequence CGACGACGACGGCGGCGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004660732_1004660744 25 Left 1004660732 6:17706829-17706851 CCGCCCCGCCGCCGTCGTCGTCG 0: 1
1: 0
2: 6
3: 43
4: 349
Right 1004660744 6:17706877-17706899 TGCGCCTATTACCCCTGCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 50
1004660732_1004660745 28 Left 1004660732 6:17706829-17706851 CCGCCCCGCCGCCGTCGTCGTCG 0: 1
1: 0
2: 6
3: 43
4: 349
Right 1004660745 6:17706880-17706902 GCCTATTACCCCTGCTAAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004660732 Original CRISPR CGACGACGACGGCGGCGGGG CGG (reversed) Exonic
900204511 1:1426337-1426359 AGACGACGGCGGCCGCGGGCAGG - Exonic
900289148 1:1916497-1916519 CGACGAAGAGGGCAACGGGGAGG + Exonic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
903034439 1:20485316-20485338 CTACGGCGACGGCGGCGACGTGG - Exonic
903446151 1:23424164-23424186 CGGCGATGGCGGGGGCGGGGCGG - Intronic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
904720066 1:32500835-32500857 CGGCGGCGGCGGCGGCGGGAAGG + Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905347006 1:37318146-37318168 CGACGCAGACGGCTCCGGGGAGG - Intergenic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907444523 1:54499382-54499404 GGACGAAGGCGGCGGCGGGATGG + Intergenic
912927903 1:113929714-113929736 CGGCGGCGGCGGCGGCGGGAAGG + Exonic
913963136 1:143354300-143354322 CGACGGCGAGGGAGGCGGGCAGG - Intergenic
914057492 1:144179886-144179908 CGACGGCGAGGGAGGCGGGCAGG - Intergenic
914121654 1:144786480-144786502 CGACGGCGAGGGAGGCGGGCAGG + Intergenic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
920255633 1:204652272-204652294 CAAGGAGGAAGGCGGCGGGGGGG - Intronic
921355563 1:214281437-214281459 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
921432798 1:215083015-215083037 CGGCGGCGGCGGCGGCGGGCAGG + Intronic
922020817 1:221702600-221702622 CGATGACGATGGTGGCGGAGCGG + Exonic
923369425 1:233295576-233295598 CGGCGGCGACGGCGGGGGCGCGG - Exonic
923369427 1:233295582-233295604 CGACGGCGGCGGCGACGGCGGGG - Exonic
924362387 1:243255117-243255139 CGACGACGACGACGAGGTGGGGG - Intronic
924362390 1:243255120-243255142 CGACGACGACGACGACGAGGTGG - Intronic
924415171 1:243850304-243850326 CGGCGGCGGCGGCGGCGGGAGGG + Intronic
924436684 1:244048908-244048930 CGGCGGCGGCGGCGGCCGGGAGG + Intergenic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064443048 10:15370870-15370892 CGGCGGCGGCGGCGGCGGGAGGG - Intronic
1066437360 10:35406865-35406887 CGACGGGGACGGAGGTGGGGGGG - Intronic
1066460324 10:35607771-35607793 CGCTGAAGACGGCGGAGGGGAGG - Exonic
1069386217 10:67885093-67885115 CGACGACGACGAGGGCGAGGAGG + Exonic
1069386218 10:67885096-67885118 CGACGACGAGGGCGAGGAGGAGG + Exonic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1072757569 10:98030865-98030887 CGGCGGCGAAGGCGGCGGCGAGG + Intergenic
1074086141 10:110210048-110210070 CGGCGGCCAGGGCGGCGGGGTGG - Intronic
1075032057 10:119030128-119030150 CGACGACGACAGCGACGAGCCGG + Exonic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1077043665 11:535285-535307 CGGCGGCGGCGGCGGCGGGTGGG - Intronic
1077386199 11:2270635-2270657 AGGCGACGGCGGCGGCGCGGAGG - Exonic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1080002208 11:27362939-27362961 CGAGGACGACGGTGACGGGGAGG - Exonic
1081831910 11:46121536-46121558 CGGCGGCGGCGGCGGCGGGCCGG - Intergenic
1081872389 11:46389426-46389448 CGACGACAGCTGGGGCGGGGCGG - Intergenic
1083055020 11:59810962-59810984 AGAAGAAGAGGGCGGCGGGGCGG + Intergenic
1083448514 11:62727006-62727028 GGACGAGGCCGGCGGCGGCGGGG - Exonic
1083595554 11:63916980-63917002 CGGCGGCGACGGCGGCGGGACGG + Intergenic
1084072393 11:66744828-66744850 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
1084892075 11:72241567-72241589 GGGCGACGACGGGGGTGGGGTGG - Intronic
1085784939 11:79440539-79440561 CGGCGAGGACGGCGGCAGGGAGG + Exonic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1087117996 11:94544528-94544550 CGCCGACGGCGGCGGCGGGCGGG + Exonic
1087117998 11:94544531-94544553 CGACGGCGGCGGCGGGCGGGCGG + Exonic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090334624 11:125954275-125954297 AGCCGAGGACGGCGGCTGGGGGG + Intergenic
1091130299 11:133140727-133140749 CGACGACGACGACGACGACGAGG + Intronic
1097267775 12:57755675-57755697 GGACGGCGACGGCGACGAGGAGG + Exonic
1098161117 12:67648905-67648927 AGAGGAGGACGGCGGCGAGGAGG + Exonic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1098898112 12:76085036-76085058 CAACGCCGAAGGGGGCGGGGCGG - Intergenic
1100963102 12:99984843-99984865 CGAGGGCGGCGGCGGCGGCGAGG + Intergenic
1102053621 12:109880431-109880453 CGCTGACGGCGGCGGCCGGGGGG - Exonic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102644663 12:114396260-114396282 CGACGCCGACCGGGGCGGCGTGG + Intronic
1103534779 12:121626869-121626891 GGACGGCGGCGGTGGCGGGGCGG - Exonic
1103659279 12:122500723-122500745 GGACGACGACGGCGACGAGGAGG - Intergenic
1103800357 12:123533738-123533760 CGGCGGCGGCGGCAGCGGGGAGG + Intergenic
1103954266 12:124567621-124567643 CGGCGGCGGCGGCGGCGGGAGGG + Intergenic
1104983381 12:132583607-132583629 CGAGGGCGGCGGCGGCGGGCGGG - Exonic
1106517086 13:30465187-30465209 CGGCGGCGGCGGCGGCCGGGCGG - Intronic
1106735855 13:32586986-32587008 CGGCGACGGCGGCGGCGGGAGGG - Intronic
1108221047 13:48233447-48233469 CCACCGCGACGGCGTCGGGGGGG - Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1112091797 13:96090809-96090831 CGGCGGCGGCGGCGGCAGGGCGG - Intergenic
1112216256 13:97434108-97434130 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1113378668 13:109784937-109784959 CGAGGGCGACGGCGGCGCGGCGG - Exonic
1114454410 14:22845877-22845899 GGACGAGGAGGGCGGCGGGGCGG + Exonic
1114483339 14:23048360-23048382 CGACGAGGGCGGCGGCGAGGAGG - Exonic
1114483340 14:23048363-23048385 CGACGACGAGGGCGGCGGCGAGG - Exonic
1114634178 14:24178112-24178134 CGACGACGGCGGCGGCGAGGAGG - Exonic
1114634179 14:24178115-24178137 CGGCGACGACGGCGGCGGCGAGG - Exonic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115235794 14:31207673-31207695 CGACGGCGGCGGCGGCGCGGCGG + Intronic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1117647367 14:57865997-57866019 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
1117875980 14:60249871-60249893 CGGCGAGGGCGGTGGCGGGGAGG + Intronic
1117920793 14:60723771-60723793 CGGCGGCGGCGGCGGCGTGGTGG + Exonic
1119003989 14:70907827-70907849 CGACGGCGGCGGCGCCGGGTGGG + Exonic
1121201432 14:92121581-92121603 TCACGGCGACGGTGGCGGGGAGG - Intronic
1122065999 14:99174906-99174928 CGACGACGCGGGCGGCTGCGGGG - Exonic
1122162375 14:99793592-99793614 CGGCGGCGACGGCGACGGCGGGG + Intronic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1124966725 15:34437420-34437442 CGGCGAGGACGGCGGCGGACCGG - Intronic
1125539581 15:40462217-40462239 CGGCGGCGACGGCGGCGGCGAGG - Exonic
1125626841 15:41115995-41116017 CCGCGACGGCGGCGGAGGGGGGG + Exonic
1125626842 15:41115998-41116020 CGACGGCGGCGGAGGGGGGGCGG + Exonic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130531041 15:84748316-84748338 CGACGACGGCGGCGGCGGGTAGG - Intergenic
1131049092 15:89334645-89334667 CGGCGGGGTCGGCGGCGGGGAGG - Intronic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132779475 16:1614654-1614676 GGGCGACGGCGGCAGCGGGGAGG + Exonic
1132793418 16:1706357-1706379 GGACGAGGGCGGCGGCGTGGTGG + Exonic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1133784512 16:8963810-8963832 CGACGACGACGCCGAGGAGGCGG - Intronic
1135572318 16:23558146-23558168 CGAAGACGCGGGCGGCGGCGCGG + Exonic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1137280495 16:46973061-46973083 CGGGGCCGACGGCCGCGGGGCGG + Intronic
1137617264 16:49855507-49855529 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
1138105710 16:54286212-54286234 CGGCGGCGACGGCGGCGGCGAGG + Exonic
1138105714 16:54286224-54286246 CGGCGGCGAGGGCGGCGGCGAGG + Exonic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139489612 16:67279343-67279365 CGGAGAGGACGGCGGCGGGCGGG + Exonic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141972394 16:87492597-87492619 CGACGACGACGACGACGACGAGG - Intergenic
1142009847 16:87708371-87708393 CGACGACGAAGACAGCGGAGAGG - Exonic
1142267440 16:89070988-89071010 GGTTGAGGACGGCGGCGGGGGGG - Intergenic
1142552947 17:752145-752167 CGGCGACGCCGGCGGCTGCGCGG + Exonic
1142611009 17:1109229-1109251 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1142799711 17:2337553-2337575 CGGCGGCGGCGGCGGCGGGCCGG + Exonic
1142806814 17:2375722-2375744 AGAGGAGGACGGCGGTGGGGAGG + Exonic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1143371637 17:6444239-6444261 CCACGAGGCTGGCGGCGGGGCGG + Intergenic
1143483903 17:7242397-7242419 CGACGACGGCGGCGACGCGCGGG + Exonic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143708618 17:8718163-8718185 CGCCCACGGTGGCGGCGGGGAGG + Intergenic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144909964 17:18672710-18672732 CGACGAGGACGGCGGGGGACGGG - Intronic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1145925649 17:28644943-28644965 CGGCGGCGGCGGCGGCGGGAGGG - Intronic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146255985 17:31391780-31391802 CGGCGATGGCGGCGGCGGGCAGG + Exonic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1147702514 17:42404800-42404822 CGACGACGACGAGGGCGGCGCGG - Exonic
1150060582 17:62065366-62065388 CGGCGGCGGCGGCGGGGGGGTGG - Intergenic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1152433119 17:80260542-80260564 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433132 17:80260572-80260594 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433145 17:80260602-80260624 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433158 17:80260632-80260654 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433171 17:80260662-80260684 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433184 17:80260692-80260714 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433197 17:80260722-80260744 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433210 17:80260752-80260774 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433223 17:80260782-80260804 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433236 17:80260812-80260834 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1154218213 18:12431343-12431365 CCACGCAGACGGCGGCGGTGGGG - Exonic
1155392722 18:25352309-25352331 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1155392757 18:25352413-25352435 CGGCGGCGACGGCGGCGGCGCGG - Intergenic
1156099661 18:33578454-33578476 CGGCGGCGGCGGCGGCGGGTGGG - Intergenic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158857132 18:61554284-61554306 CGACGACGAGGGCGGCGGCGAGG + Exonic
1158857133 18:61554287-61554309 CGACGAGGGCGGCGGCGAGGAGG + Exonic
1158880991 18:61779630-61779652 GGACCACGGCGGCGGGGGGGTGG - Intergenic
1158976614 18:62716093-62716115 CGAGGACGACGACGACGAGGAGG - Exonic
1159251292 18:65880495-65880517 CGATGACGAGGGCGGGGGAGAGG + Exonic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1159798107 18:72867788-72867810 CGGCGCCGGCGGCGGCGGGGTGG + Exonic
1160864029 19:1249399-1249421 CCCGGACGAAGGCGGCGGGGTGG + Intronic
1160913731 19:1487191-1487213 CGAGGACGACGGCCGCACGGTGG - Exonic
1160930585 19:1567992-1568014 CGGCGGCGGCGGCGGCGTGGGGG - Exonic
1160967699 19:1753830-1753852 CGGCGGCGGCGGCGGCGGTGGGG + Exonic
1161293241 19:3506750-3506772 CGCTGACGGCGGCTGCGGGGAGG - Intronic
1161314901 19:3613247-3613269 CGACGGCGACGGGGACGGTGAGG - Exonic
1161779189 19:6279856-6279878 AGACAATGAGGGCGGCGGGGCGG - Exonic
1161939802 19:7395246-7395268 AGGTGAGGACGGCGGCGGGGCGG + Intronic
1162021359 19:7869923-7869945 CGAGGGCGGCGGCGGCGGGCCGG + Exonic
1162420091 19:10561216-10561238 GGACGAGGACGGCGCTGGGGAGG - Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1163473476 19:17511651-17511673 TGGCGAGGGCGGCGGCGGGGAGG - Exonic
1164895709 19:31875731-31875753 CGCTGACGACGGCGACAGGGAGG + Intergenic
1165803135 19:38565188-38565210 CGGCGGCCACGGCGGCGGCGGGG + Exonic
1167426301 19:49431443-49431465 CGAAGCCTACGGGGGCGGGGGGG + Exonic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1168076353 19:53982609-53982631 CGGCGGAGGCGGCGGCGGGGCGG + Exonic
1168272639 19:55258489-55258511 CGGAGCCGCCGGCGGCGGGGCGG - Exonic
1168290564 19:55355145-55355167 GGAGGACGAGGGGGGCGGGGGGG - Intronic
1168335042 19:55592779-55592801 CCACGGTGAGGGCGGCGGGGAGG - Exonic
1202696976 1_KI270712v1_random:132559-132581 CGACGGCGAGGGAGGCGGGCAGG - Intergenic
926878584 2:17514521-17514543 GGAGGCCGAGGGCGGCGGGGGGG + Intronic
927136778 2:20102766-20102788 CGACGACAACGGTGGTGAGGGGG + Intergenic
927472215 2:23385242-23385264 GGACGGCGGCGGCGGCGCGGGGG - Exonic
927472218 2:23385245-23385267 CGGGGACGGCGGCGGCGGCGCGG - Exonic
928511799 2:32010144-32010166 AGGCGGCGACGGCGGCGGGCGGG + Intronic
929174230 2:38960549-38960571 CGGCGACGGCGGCGGCGGCCGGG - Exonic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931253850 2:60554146-60554168 CGAGCGCGGCGGCGGCGGGGAGG - Intergenic
932005985 2:67927423-67927445 CTACTAACACGGCGGCGGGGGGG + Intergenic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934278136 2:91589573-91589595 CGACGGCGAGGGAGGCGGGCAGG - Intergenic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
941666422 2:168247540-168247562 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
942674590 2:178413658-178413680 CAACGAAGACGGCGGCGCGGAGG - Intergenic
945648936 2:212537138-212537160 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
948370573 2:237487040-237487062 GGAGAAAGACGGCGGCGGGGAGG - Intronic
1169065570 20:2692815-2692837 CGGCGGCGGCGGCGGCGGGATGG + Intergenic
1169065596 20:2692873-2692895 CGGCGGCGGCCGCGGCGGGGCGG + Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1173843692 20:46174958-46174980 CGACGAAGGCGGCGGCGAGCAGG - Exonic
1174258546 20:49277396-49277418 TGAGGACGGAGGCGGCGGGGTGG + Intronic
1174357826 20:50010107-50010129 CGGCGGCGGCGGCGGCGAGGGGG + Intergenic
1175429113 20:58890276-58890298 CGACGACGACGAGGGCGCCGAGG + Intronic
1175429114 20:58890279-58890301 CGACGACGAGGGCGCCGAGGAGG + Intronic
1175429371 20:58891234-58891256 CGGCGGCGGCGGCGGCTGGGAGG - Intronic
1176080867 20:63272531-63272553 GGCCGACAACGGGGGCGGGGCGG - Intronic
1176547048 21:8206608-8206630 CGACGCAGAAGGCGGCGGGCGGG - Intergenic
1176554953 21:8250817-8250839 CGACGCAGAAGGCGGCGGGCGGG - Intergenic
1176565999 21:8389655-8389677 CGACGCAGAAGGCGGCGGGCGGG - Intergenic
1176573874 21:8433842-8433864 CGACGCAGAAGGCGGCGGGCGGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179674888 21:42974681-42974703 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1181057846 22:20268296-20268318 CGAGGGCGGCGGCGGCGCGGGGG + Exonic
1183247220 22:36703249-36703271 CGGCGGCGGCGGCGGCAGGGCGG + Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183466663 22:37983664-37983686 CGACGGCGGCGGCGGCGGATCGG - Exonic
1184337496 22:43862376-43862398 CGGCGACGGCGGCGGCATGGCGG - Exonic
1184337497 22:43862379-43862401 CGACGGCGACGGCGGCGGCATGG - Exonic
1184523803 22:45009869-45009891 CGGCGGCGGCGGCGGCTGGGCGG - Intronic
1184557393 22:45240748-45240770 CGGGGGCGGCGGCGGCGGGGAGG + Intronic
1185347525 22:50317011-50317033 CGGCGAGGACGGGGGGGGGGCGG + Intronic
1185398641 22:50604907-50604929 CGAAGAGGACAGCGGCGGGGAGG + Exonic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203251923 22_KI270733v1_random:122893-122915 CGACGCAGAAGGCGGCGGGCGGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203259974 22_KI270733v1_random:167976-167998 CGACGCAGAAGGCGGCGGGCGGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
951078594 3:18425405-18425427 CGAGGAGGAAGGCGGCGTGGGGG + Intronic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
955769232 3:62372517-62372539 TGGCGGCGGCGGCGGCGGGGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962575522 3:136752158-136752180 CGGCGACGGCGGCGGGGGGCGGG - Intronic
964482889 3:157159978-157160000 CGACGACGACCACGACGGGAGGG - Exonic
964801684 3:160565184-160565206 CGGGGACGACGCCGGAGGGGTGG - Intronic
965796890 3:172448932-172448954 TGAAGACGACGGTGGCGGTGGGG + Intergenic
965796891 3:172448935-172448957 AGACGACGGTGGCGGTGGGGAGG + Intergenic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966911415 3:184562246-184562268 CGACGGCGGCGGCGGCGGGCGGG - Exonic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
967916721 3:194583899-194583921 CGGCGGCTGCGGCGGCGGGGCGG + Intergenic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
975778967 4:77819622-77819644 CGGCGGCGGCGGCGACGGGGCGG + Intergenic
977257549 4:94757921-94757943 CGGCGGCGGCGGCGGCGGAGCGG + Intergenic
977810066 4:101347530-101347552 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
981429891 4:144646242-144646264 AAACGGCGACGGCGGCGGCGGGG - Exonic
981803244 4:148682321-148682343 CGATGACGATGGCAGTGGGGTGG + Intergenic
982712204 4:158768942-158768964 CCACGGCGGCGGCGGCGGCGCGG - Intergenic
982745824 4:159103438-159103460 CGGCGGCGGCGGCGGCTGGGCGG + Intergenic
984734766 4:183099003-183099025 CGGCGACGCCGGCAGCGGCGGGG + Intergenic
985895646 5:2748891-2748913 CGACGAGGACGACGACGAGGAGG - Exonic
986330579 5:6713838-6713860 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987258268 5:16179474-16179496 CGGCGTCGGCGGCGGCGGCGGGG + Exonic
988999461 5:36745322-36745344 CGACTAGAACGGTGGCGGGGAGG + Intergenic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990509912 5:56480962-56480984 CGAGGAGGACAGGGGCGGGGTGG + Intronic
992530143 5:77645318-77645340 CGGCGACGGCGGCGGCGGCGCGG - Intergenic
997302322 5:132814511-132814533 CGCGGACGGCGGCGGCGCGGCGG - Exonic
997454070 5:134004759-134004781 CGGCGCGGACGGCGGCGGCGCGG + Intronic
997654175 5:135543615-135543637 CGGCGGCGACGGCGGCGGCAAGG - Intergenic
1002204658 5:177554281-177554303 CGACCACGACGGCCCCAGGGAGG - Exonic
1002527070 5:179820799-179820821 CGACGACGGTGGCGGGGGCGGGG + Exonic
1002527071 5:179820802-179820824 CGACGGTGGCGGGGGCGGGGAGG + Exonic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002621974 5:180494464-180494486 CGGCGGCGACGGCGGCGCGGAGG + Exonic
1002670346 5:180861357-180861379 CGACGGCGCCGGCGGGAGGGAGG + Intergenic
1002897857 6:1389746-1389768 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1004504724 6:16238648-16238670 CGGCGGCGACGGCGGGGCGGGGG - Exonic
1004504727 6:16238651-16238673 CGGCGGCGGCGACGGCGGGGCGG - Exonic
1004660732 6:17706829-17706851 CGACGACGACGGCGGCGGGGCGG - Exonic
1004660733 6:17706832-17706854 CGACGACGACGACGGCGGCGGGG - Exonic
1004690346 6:17987691-17987713 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1005912863 6:30326512-30326534 CGACGAAGAGGGCGGGGCGGGGG - Intronic
1007424061 6:41735499-41735521 CGGCGCCGACGGCGGCGGGAAGG - Intronic
1007680340 6:43629198-43629220 CGGCGACGGCGGCGGCGGTCGGG - Intergenic
1007785315 6:44276371-44276393 CGACGAGGACGACGACGAGGAGG + Exonic
1010415045 6:75602464-75602486 CGGCGAGCACGGCGGCGGTGTGG + Exonic
1012245755 6:96924398-96924420 CGAGGAGGAGGGCGGCGTGGAGG + Intergenic
1013273348 6:108561403-108561425 CGACGAGGACGGCGGGGGACGGG + Exonic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1017103090 6:150865717-150865739 CGGCGGCGGCGGCGGCGGGAAGG - Exonic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1018400213 6:163414301-163414323 CGGGGCCGACGGCCGCGGGGGGG - Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1019111906 6:169723945-169723967 CGACGGCGGCGGCGGCGGCGCGG - Exonic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1020224920 7:6272483-6272505 GGATGAAGACGGCGGCGGCGAGG - Exonic
1020274293 7:6615498-6615520 CGACGGCGGCGGCGGCGGCGGGG + Intergenic
1021614396 7:22487556-22487578 CGAGGATGGCGGGGGCGGGGGGG + Intronic
1022106303 7:27199996-27200018 CGACAACGGCGGCGGCCTGGTGG - Exonic
1022106304 7:27199999-27200021 CTACGACAACGGCGGCGGCCTGG - Exonic
1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG + Intronic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1031361978 7:120857965-120857987 AGGCGGCGACGGCGGCGGCGGGG - Exonic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034469718 7:151248750-151248772 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
1034483539 7:151341733-151341755 CGAAGGCGACAGCGGCGGCGGGG + Exonic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041709201 8:60877337-60877359 CGAGGCGGATGGCGGCGGGGAGG + Intergenic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1042532859 8:69832990-69833012 CGGCGGCGGCGGCGGCGGAGGGG - Exonic
1044692898 8:94896266-94896288 CGCTGGCGGCGGCGGCGGGGCGG - Intronic
1045098772 8:98825458-98825480 CGGCGCCGGCGGCCGCGGGGCGG - Intronic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047255644 8:123211637-123211659 CGCAGACGACGGCGGCGCGCCGG + Intergenic
1047292287 8:123541109-123541131 CCGCGACGGGGGCGGCGGGGCGG + Exonic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049761473 8:144333775-144333797 CGACGGCGACGCCGGAGGCGGGG - Exonic
1049762273 8:144336902-144336924 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1049998394 9:1051757-1051779 CGACGAAGATGACGACGGGGTGG + Exonic
1050357008 9:4792980-4793002 CGACACCGACGGCGGCGGCTCGG - Exonic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054496324 9:65825664-65825686 CGAGGCGGACGGCGGCGGCGCGG + Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1056643408 9:88388991-88389013 GGCCGGCGACGGGGGCGGGGCGG + Intronic
1057232856 9:93335381-93335403 CAACGACGAGGGCAGCGGAGGGG - Exonic
1057252656 9:93516240-93516262 CAACGACGAGGGCAGCGGAGGGG + Exonic
1058885836 9:109320694-109320716 CGGCGGCGGCGGCGGCGGGACGG - Exonic
1059474399 9:114532825-114532847 TGACGGCGACGGCGGGGGCGGGG + Intergenic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060770174 9:126326813-126326835 CGGCGGCGGCGGCGGAGGGGCGG - Intergenic
1060770175 9:126326816-126326838 CGGCGGCGGCGGCGGCGGAGGGG - Intergenic
1061541084 9:131278045-131278067 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1062305957 9:135907305-135907327 CGGCGACGGCGGCGGCTGTGAGG - Intergenic
1062562002 9:137145836-137145858 CGACGACCACGAGGGCCGGGCGG + Exonic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203468325 Un_GL000220v1:106044-106066 CGACGCAGAAGGCGGCGGGCGGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203476146 Un_GL000220v1:150016-150038 CGACGCAGAAGGCGGCGGGCGGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1188003527 X:25002648-25002670 CGGCGGCGGCGGCGGCGTGGCGG + Intergenic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1190261732 X:48801957-48801979 CGTCGACGGCGGAGGCGGGAAGG + Intronic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192034376 X:67546550-67546572 CGGCGGCGGCGGCGGCGAGGCGG + Exonic
1195138169 X:101931763-101931785 CCACTATGGCGGCGGCGGGGAGG - Exonic
1195649752 X:107272611-107272633 CTACGACTATGACGGCGGGGAGG + Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198767097 X:140091348-140091370 CGGCGGCGGCGGCGGCTGGGAGG + Intergenic