ID: 1004665084

View in Genome Browser
Species Human (GRCh38)
Location 6:17741906-17741928
Sequence TTGTAGGTGTCTAAAGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004665077_1004665084 27 Left 1004665077 6:17741856-17741878 CCTCAGCTGGGCTTAGTGCCTAT No data
Right 1004665084 6:17741906-17741928 TTGTAGGTGTCTAAAGTTGATGG No data
1004665080_1004665084 9 Left 1004665080 6:17741874-17741896 CCTATGAGGACTGCAGAGGACAG No data
Right 1004665084 6:17741906-17741928 TTGTAGGTGTCTAAAGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004665084 Original CRISPR TTGTAGGTGTCTAAAGTTGA TGG Intergenic
No off target data available for this crispr