ID: 1004665084 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:17741906-17741928 |
| Sequence | TTGTAGGTGTCTAAAGTTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1004665077_1004665084 | 27 | Left | 1004665077 | 6:17741856-17741878 | CCTCAGCTGGGCTTAGTGCCTAT | No data | ||
| Right | 1004665084 | 6:17741906-17741928 | TTGTAGGTGTCTAAAGTTGATGG | No data | ||||
| 1004665080_1004665084 | 9 | Left | 1004665080 | 6:17741874-17741896 | CCTATGAGGACTGCAGAGGACAG | No data | ||
| Right | 1004665084 | 6:17741906-17741928 | TTGTAGGTGTCTAAAGTTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1004665084 | Original CRISPR | TTGTAGGTGTCTAAAGTTGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||