ID: 1004666047

View in Genome Browser
Species Human (GRCh38)
Location 6:17749532-17749554
Sequence CACAGATTCAGTATATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004666047_1004666053 28 Left 1004666047 6:17749532-17749554 CCTGTCTATATACTGAATCTGTG No data
Right 1004666053 6:17749583-17749605 GCTACATTTTATCACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004666047 Original CRISPR CACAGATTCAGTATATAGAC AGG (reversed) Intergenic
No off target data available for this crispr