ID: 1004666050

View in Genome Browser
Species Human (GRCh38)
Location 6:17749564-17749586
Sequence TAGCTCTTGACTAAAGATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004666050_1004666056 16 Left 1004666050 6:17749564-17749586 CCCCAATCTTTAGTCAAGAGCTA No data
Right 1004666056 6:17749603-17749625 AGGCTGGAGATCACCAGATAAGG No data
1004666050_1004666057 17 Left 1004666050 6:17749564-17749586 CCCCAATCTTTAGTCAAGAGCTA No data
Right 1004666057 6:17749604-17749626 GGCTGGAGATCACCAGATAAGGG No data
1004666050_1004666058 18 Left 1004666050 6:17749564-17749586 CCCCAATCTTTAGTCAAGAGCTA No data
Right 1004666058 6:17749605-17749627 GCTGGAGATCACCAGATAAGGGG No data
1004666050_1004666053 -4 Left 1004666050 6:17749564-17749586 CCCCAATCTTTAGTCAAGAGCTA No data
Right 1004666053 6:17749583-17749605 GCTACATTTTATCACCTTAAAGG No data
1004666050_1004666054 0 Left 1004666050 6:17749564-17749586 CCCCAATCTTTAGTCAAGAGCTA No data
Right 1004666054 6:17749587-17749609 CATTTTATCACCTTAAAGGCTGG No data
1004666050_1004666059 19 Left 1004666050 6:17749564-17749586 CCCCAATCTTTAGTCAAGAGCTA No data
Right 1004666059 6:17749606-17749628 CTGGAGATCACCAGATAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004666050 Original CRISPR TAGCTCTTGACTAAAGATTG GGG (reversed) Intergenic
No off target data available for this crispr