ID: 1004666053

View in Genome Browser
Species Human (GRCh38)
Location 6:17749583-17749605
Sequence GCTACATTTTATCACCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004666052_1004666053 -6 Left 1004666052 6:17749566-17749588 CCAATCTTTAGTCAAGAGCTACA No data
Right 1004666053 6:17749583-17749605 GCTACATTTTATCACCTTAAAGG No data
1004666051_1004666053 -5 Left 1004666051 6:17749565-17749587 CCCAATCTTTAGTCAAGAGCTAC No data
Right 1004666053 6:17749583-17749605 GCTACATTTTATCACCTTAAAGG No data
1004666047_1004666053 28 Left 1004666047 6:17749532-17749554 CCTGTCTATATACTGAATCTGTG No data
Right 1004666053 6:17749583-17749605 GCTACATTTTATCACCTTAAAGG No data
1004666050_1004666053 -4 Left 1004666050 6:17749564-17749586 CCCCAATCTTTAGTCAAGAGCTA No data
Right 1004666053 6:17749583-17749605 GCTACATTTTATCACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004666053 Original CRISPR GCTACATTTTATCACCTTAA AGG Intergenic
No off target data available for this crispr