ID: 1004673270

View in Genome Browser
Species Human (GRCh38)
Location 6:17817135-17817157
Sequence GCTCATGTATGAGCGGGAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004673270_1004673273 -8 Left 1004673270 6:17817135-17817157 CCAGTTCCCGCTCATACATGAGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1004673273 6:17817150-17817172 ACATGAGCCGCTGCTCCTCTAGG 0: 1
1: 0
2: 2
3: 18
4: 113
1004673270_1004673278 28 Left 1004673270 6:17817135-17817157 CCAGTTCCCGCTCATACATGAGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1004673278 6:17817186-17817208 CTTCTAGGTATTGTTTCTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 168
1004673270_1004673277 13 Left 1004673270 6:17817135-17817157 CCAGTTCCCGCTCATACATGAGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1004673277 6:17817171-17817193 GGGCACTTCTCTTTTCTTCTAGG 0: 1
1: 0
2: 2
3: 36
4: 296
1004673270_1004673274 -7 Left 1004673270 6:17817135-17817157 CCAGTTCCCGCTCATACATGAGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1004673274 6:17817151-17817173 CATGAGCCGCTGCTCCTCTAGGG 0: 1
1: 0
2: 0
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004673270 Original CRISPR GCTCATGTATGAGCGGGAAC TGG (reversed) Exonic
907583780 1:55596057-55596079 GCCCACGTATGAGTGAGAACAGG + Intergenic
909822865 1:80087957-80087979 TCCCATGTATGAGTGAGAACAGG + Intergenic
919249876 1:195040445-195040467 GCTAATGTATGAGCAATAACTGG + Intergenic
920834286 1:209494267-209494289 GCTCATGTTGGATGGGGAACAGG - Intergenic
1063691672 10:8293372-8293394 GCTCATCTATGAGCGATAACAGG - Intergenic
1068689848 10:59904833-59904855 TCTCATGTATGAGCCAGCACTGG + Intronic
1074696725 10:116056530-116056552 GCTCATTTATGAGCAGTAAAAGG - Intergenic
1074893389 10:117753986-117754008 TCTCATCTATGAGAGGGAAGAGG - Intergenic
1077794243 11:5474777-5474799 GCTCAGGTATGACAGTGAACAGG + Intronic
1093650002 12:21632235-21632257 TCTCATGGCTGAGCTGGAACTGG - Intergenic
1105706922 13:22973014-22973036 GCTCAAGTTTGAGAGGGAAAGGG + Intergenic
1105962218 13:25352541-25352563 GCACATGTGTGAGGGGGTACTGG + Intergenic
1113560324 13:111273597-111273619 GCTCATATGAGAGCAGGAACGGG + Intronic
1114538054 14:23435603-23435625 TCTCAGGTAGGAGCGGGAGCTGG - Exonic
1115317380 14:32039227-32039249 GCTCAGGTGTCAGAGGGAACTGG + Intergenic
1121841975 14:97142038-97142060 GCTCATGGAAGAGAGGGAATAGG + Intergenic
1122850828 14:104529507-104529529 GCTCAAGTTTGAGAGGGAAAGGG + Intronic
1136178820 16:28537283-28537305 GCTCATGAATGTGCAGGCACAGG + Intronic
1143563096 17:7706562-7706584 ACTCTTTTATGAGCGGGAAGTGG - Intronic
1143734394 17:8900352-8900374 CCTCATTAATGAGCGGGCACAGG + Intronic
1147039166 17:37704211-37704233 GCCCATGTATGGGAGGGCACAGG + Intronic
1147699946 17:42387807-42387829 TCTCCTGAAGGAGCGGGAACAGG + Intronic
1151717777 17:75840227-75840249 GCTTATGGATGAGTTGGAACTGG + Exonic
925386525 2:3465699-3465721 GCTCATGTCTGACCGTGCACAGG - Intronic
939081674 2:137670264-137670286 GCTCATCTATGAGTAGGAAAGGG - Intronic
942870458 2:180728273-180728295 GCTCCTATCTGAGTGGGAACAGG - Intergenic
948700603 2:239757390-239757412 GCTCATGTGAGAGTGGGAAGTGG - Intergenic
1169049398 20:2563122-2563144 GCTCATGTATGAGAGGAGCCAGG - Intronic
1175892188 20:62320846-62320868 GCTCCTGGATGACCTGGAACGGG - Exonic
953059293 3:39413988-39414010 GCTCATTTATGAGCGGGTTCTGG + Intergenic
953248880 3:41224695-41224717 AGTCCTGTATGAGTGGGAACAGG + Exonic
953634652 3:44652520-44652542 GCACATGTTTAAGAGGGAACTGG - Intronic
956206253 3:66758151-66758173 GCTCATGTAACAGTGGGAACTGG - Intergenic
957024579 3:75166996-75167018 TCTCATGTATCAGCAGGAACAGG - Intergenic
966498551 3:180609841-180609863 GCTGAAGTATTAGCTGGAACTGG - Exonic
978211197 4:106137425-106137447 GCTCATGCAAGAGGGGGTACAGG + Intronic
996000901 5:118362389-118362411 TCTCATGTATAAGTGGGAGCTGG + Intergenic
996481520 5:123980830-123980852 GGACATGTATAAGTGGGAACAGG + Intergenic
1004673270 6:17817135-17817157 GCTCATGTATGAGCGGGAACTGG - Exonic
1005900528 6:30213367-30213389 GCTCGTGCAGGAGCGGGACCCGG - Intronic
1007623031 6:43226348-43226370 GCTCATCCATGAGCAGGACCTGG - Exonic
1013645780 6:112139580-112139602 GCTCATCTATGATAGAGAACAGG + Intronic
1014331606 6:120073934-120073956 GCTCATGTATAAGCAGAAATAGG - Intergenic
1030708142 7:112716492-112716514 TCCCATGTATGAGTGAGAACAGG + Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1039221167 8:35332751-35332773 GTTCATGTAAGAGTGGGGACCGG - Intronic
1043668848 8:82855101-82855123 TCTCACTTATGAGTGGGAACTGG + Intergenic
1058420189 9:104826184-104826206 GCGCATGTGTGTGGGGGAACAGG - Intronic