ID: 1004674715

View in Genome Browser
Species Human (GRCh38)
Location 6:17830541-17830563
Sequence CGACCACAGTGGCAACAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004674710_1004674715 -5 Left 1004674710 6:17830523-17830545 CCAACGTGGCATGTCCTGCGACC 0: 1
1: 0
2: 1
3: 4
4: 40
Right 1004674715 6:17830541-17830563 CGACCACAGTGGCAACAGGGCGG 0: 1
1: 0
2: 1
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004674715 Original CRISPR CGACCACAGTGGCAACAGGG CGG Intronic
901117985 1:6864387-6864409 GGACCACATTGGCATCTGGGTGG - Intronic
902266773 1:15272615-15272637 CGATCACAGTGGCACCAATGTGG - Intronic
904771294 1:32882721-32882743 GGACCAAAGAGGCAACAAGGTGG + Intergenic
910901506 1:92126323-92126345 CAACCACTGTGGCAGCAGGAGGG - Intronic
915910365 1:159911217-159911239 AGACTACAGTGGACACAGGGTGG - Intergenic
917154705 1:171984131-171984153 AGACCAGGGTGGCAACAGTGGGG - Intronic
920313580 1:205062384-205062406 GGACCACAGGAGCCACAGGGAGG - Intronic
922402282 1:225272660-225272682 CGACTACAGTGCTAACATGGAGG - Intronic
924216980 1:241832390-241832412 AGGCCACAGGGGCAAGAGGGTGG + Intergenic
1064575256 10:16738900-16738922 AGAACACAGGGACAACAGGGAGG - Intronic
1073542419 10:104324606-104324628 GGAGCCCAGTGGCCACAGGGTGG - Intronic
1076077151 10:127543102-127543124 CTACCACAGTGAAAACAGTGTGG - Intergenic
1076503022 10:130951804-130951826 GGACCACTGAGGCACCAGGGTGG - Intergenic
1076624734 10:131814900-131814922 TGGCCACAGTAGCAACAGGCTGG + Intergenic
1077046579 11:549353-549375 TGGCTACAGTGGGAACAGGGTGG + Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077700665 11:4439118-4439140 AGACCAGAGTGGCAGCAGGGAGG + Intergenic
1078896900 11:15604863-15604885 TCACCTCAGTGGCACCAGGGAGG - Intergenic
1080223529 11:29934346-29934368 CGAGCACAGTGGCAGCAGGGCGG - Intergenic
1081744514 11:45463496-45463518 CGACCAGAGTGGGAAGAGGTGGG - Intergenic
1084981355 11:72830403-72830425 GGCCCACAGTGGCAGGAGGGTGG - Intronic
1086920434 11:92580755-92580777 AGACCACAATGGCAAAAGTGGGG - Intronic
1090259157 11:125306250-125306272 CGACCAAATTGGCAACTGGTGGG - Intronic
1090766021 11:129877040-129877062 CAACCACAGTGGGAAAAGGATGG + Intronic
1092030585 12:5280327-5280349 CCATTACTGTGGCAACAGGGTGG + Intergenic
1092916776 12:13196521-13196543 AGACCACAGTGGAAAAAAGGAGG - Intergenic
1094017940 12:25884421-25884443 CCATCACAGTGGCTTCAGGGAGG - Intergenic
1096504436 12:52083589-52083611 TGCCCACACTGGCCACAGGGGGG - Intergenic
1098184678 12:67883612-67883634 CCCCCACAGAGGCAAGAGGGAGG - Intergenic
1102652776 12:114454515-114454537 GGACCACAGTGGGAGGAGGGGGG + Intergenic
1104662834 12:130623900-130623922 CACCCACAGTGGCAACTGGCTGG + Intronic
1105302485 13:19148906-19148928 AAATCACAGTGGCAGCAGGGAGG + Intergenic
1109229402 13:59738310-59738332 GGACCACAGAGGCAAGAGGGTGG + Intronic
1112699126 13:101984089-101984111 CCACAGCAGTGGCAACAGGAAGG - Intronic
1113940190 13:114014885-114014907 CGACCACAGTGGTCTCTGGGGGG - Intronic
1114474576 14:22984745-22984767 CTACCAGAGTGGAAGCAGGGAGG + Intergenic
1124484362 15:30102113-30102135 AGAACACAGTGGCATCAGGGTGG + Intergenic
1124519221 15:30395111-30395133 AGAACACAGTGGCATCAGGGTGG - Intergenic
1124539435 15:30571110-30571132 AGAACACAGTGGCATCAGGGTGG + Intergenic
1124759215 15:32436462-32436484 AGAACACAGTGGCATCAGGGTGG - Intergenic
1126919101 15:53500599-53500621 CAACCACTGTGGAAACAGTGTGG - Intergenic
1129330355 15:74823957-74823979 TGACCAGAGGGGAAACAGGGTGG + Intronic
1132406474 15:101544271-101544293 TGACCACAGTGGCCACGGCGTGG - Intergenic
1132826834 16:1909394-1909416 AGACTGCAGTGGCAACATGGTGG - Intergenic
1134915241 16:18063801-18063823 CCTGCACAGTGGCAACAGGGAGG + Intergenic
1134935681 16:18243588-18243610 CTCCCTCAGTGGCAACAGGCAGG + Intergenic
1140349374 16:74247514-74247536 GGAACTCAGTGGGAACAGGGGGG - Intergenic
1145145617 17:20477040-20477062 AGACCACTGTGGCTACAGTGTGG - Intergenic
1146266266 17:31454953-31454975 GCACCACAGTGGGAACAGGCAGG + Intronic
1149994978 17:61401556-61401578 CGACCACAGGGGAAACAGCCAGG + Intronic
1150852271 17:68714977-68714999 CTACCACAGTAGTCACAGGGGGG - Intergenic
1154050534 18:10952182-10952204 CGACCACAGTGGTAACACATTGG - Intronic
1157271686 18:46281135-46281157 CGACCACAGCGGAGACAGTGTGG + Intergenic
1158527010 18:58223999-58224021 CTCCCACAGGGGCCACAGGGAGG + Intronic
1161027978 19:2045457-2045479 GGACCACAGTGGCAGCAGGCAGG - Intronic
1161426328 19:4205498-4205520 GGACCAGAGTGGAAACAGGGAGG - Intronic
1161467866 19:4442179-4442201 CTACCGCACTGGCACCAGGGTGG + Intronic
1163328151 19:16618547-16618569 GGTCCAGAGTAGCAACAGGGTGG - Intronic
1167705004 19:51076775-51076797 GGACCACAGGGGCTCCAGGGAGG + Intergenic
925973195 2:9122115-9122137 GGACCATGGGGGCAACAGGGAGG + Intergenic
929688155 2:44052240-44052262 GGGCCACAGGGGGAACAGGGAGG + Intergenic
931225473 2:60325466-60325488 CAATCACATTGGCAAAAGGGTGG - Intergenic
932813967 2:74846814-74846836 CAACCACAGTCAAAACAGGGTGG - Intronic
933716556 2:85365735-85365757 GAACCACAGTGGCAAGGGGGTGG - Intronic
935651662 2:105387305-105387327 AAATCACAGTGGCAAAAGGGAGG + Intronic
937920798 2:127128695-127128717 CCTCCACACTGGCAGCAGGGTGG - Intergenic
938251293 2:129817535-129817557 TCACCACAGTGGGAAAAGGGTGG - Intergenic
944222655 2:197317733-197317755 ACAACACAGTGGGAACAGGGAGG + Intergenic
946182136 2:217955216-217955238 CGCCCGCAGTGCCAACTGGGAGG + Intronic
948706990 2:239801105-239801127 CGAAGAGACTGGCAACAGGGAGG - Exonic
948938341 2:241182887-241182909 CGACCTCAGGAGCAACAGGTGGG - Exonic
1170025013 20:11879528-11879550 TGGCCACAGTGGTAACATGGTGG + Intergenic
1171484619 20:25477813-25477835 AGACCCCAGTGGGAACAGAGGGG - Intronic
1172386890 20:34540300-34540322 CCACGACAGTGGCAGCAGGTAGG - Intronic
1172655032 20:36531663-36531685 TGACCACAGAGGCAGCAGAGGGG + Intergenic
1172880508 20:38196683-38196705 TGACCACAGAGGGCACAGGGAGG - Intergenic
1178308515 21:31510201-31510223 CGACCAAAGGGCCAGCAGGGTGG + Intronic
1180624023 22:17181971-17181993 CCATCAGAGTGGCTACAGGGTGG + Exonic
1182880050 22:33725292-33725314 GGAGCACAGAGGCGACAGGGTGG + Intronic
1183337886 22:37261060-37261082 AGGCCACAGTGACACCAGGGCGG + Intergenic
1184505906 22:44902038-44902060 ACACCACAGAGGCAAGAGGGCGG + Intronic
951693463 3:25421045-25421067 CTTCCACAGGGGCAGCAGGGTGG + Intronic
953903147 3:46854581-46854603 GGGCCACAGGGGCAGCAGGGAGG - Intergenic
953999595 3:47545247-47545269 AGACCACAGTGGCCATAGGATGG + Intergenic
955939576 3:64134702-64134724 CTACCCCAGGGGAAACAGGGTGG - Intronic
958269418 3:91480593-91480615 TCACCACAATAGCAACAGGGTGG + Intergenic
959084307 3:101834815-101834837 CGATCACAGTGGCAGCTGTGTGG - Intronic
959208807 3:103348986-103349008 AGACCACCTTGGCAACAGCGAGG - Intergenic
961393186 3:126568829-126568851 GGACCACAGAGGCGGCAGGGGGG + Intergenic
962090305 3:132237476-132237498 AGACTACAGTGCCAACAGAGTGG - Intronic
964486191 3:157187090-157187112 CAACAACAGTGGCAGCAAGGCGG - Intergenic
964803874 3:160585387-160585409 GCACCACAGAGGCAAGAGGGTGG + Intergenic
965813516 3:172614777-172614799 GGTCCAGAGTGGCAGCAGGGCGG + Intergenic
969885212 4:10209316-10209338 AGAGCACAGGGGCAAGAGGGTGG + Intergenic
976593288 4:86870649-86870671 GCACCACAGAGGCAAAAGGGTGG + Intergenic
985638608 5:1052664-1052686 GGAGCACCGTGGCCACAGGGAGG + Intronic
985969348 5:3362722-3362744 TGAACACAGTGGCAAAGGGGAGG + Intergenic
988463287 5:31462063-31462085 CTTACACAGTGGCAACATGGGGG - Intronic
989153948 5:38326393-38326415 TGACCAAAGTGCCATCAGGGAGG - Intronic
990124649 5:52499143-52499165 TGTCTACAGTGGCAATAGGGTGG + Intergenic
997365273 5:133321508-133321530 CACCCACAGGGGCACCAGGGAGG - Intronic
997978959 5:138457390-138457412 CGGGTACAGTGGCAGCAGGGTGG - Intergenic
1000408712 5:160916057-160916079 CTACCTCAGTGGGAACATGGAGG - Intergenic
1001758034 5:174185857-174185879 CCAGGACAGTGGCAAGAGGGTGG - Intronic
1002294416 5:178222411-178222433 CGGCCACGCAGGCAACAGGGTGG + Exonic
1004220739 6:13743955-13743977 CCCCCACAGTGGTAACAGCGCGG + Intergenic
1004674715 6:17830541-17830563 CGACCACAGTGGCAACAGGGCGG + Intronic
1008614527 6:53213383-53213405 CCACCAAAGTGGGATCAGGGAGG + Intergenic
1008985739 6:57540830-57540852 TCACCACAGTAGCAACAGGGTGG - Intronic
1009173766 6:60433699-60433721 TCACCACAATAGCAACAGGGTGG - Intergenic
1015390481 6:132676034-132676056 TCACCACAGTAGCAACAGGAAGG + Intergenic
1016892093 6:149016864-149016886 CTGCAGCAGTGGCAACAGGGAGG - Intronic
1017872970 6:158502336-158502358 CGACAGCAGTGGCAACGTGGAGG + Exonic
1023859982 7:44212779-44212801 CCACCACAGAGGCCACAGGCAGG + Exonic
1024241030 7:47435996-47436018 GGCCCACAGTGGCCACACGGGGG + Intronic
1024618684 7:51138342-51138364 CCACCTCCATGGCAACAGGGAGG + Intronic
1027808813 7:82865805-82865827 AGACCAAGGTGGGAACAGGGAGG - Intronic
1034683573 7:152949924-152949946 TGACCACAGTGACCACAGTGAGG + Intergenic
1037420170 8:18693649-18693671 CCACCACAACTGCAACAGGGGGG - Intronic
1037754103 8:21700396-21700418 CGGCCACAGGGCCAACTGGGAGG + Intronic
1039093680 8:33859738-33859760 ACACCACAGGGGCAAGAGGGTGG - Intergenic
1040671604 8:49698076-49698098 TGACCATAGAGGCACCAGGGAGG + Intergenic
1044150351 8:88769428-88769450 CCACCACAAGGGCAAAAGGGAGG - Intergenic
1049204586 8:141357852-141357874 CCACCGCAGTGACAACAGTGCGG - Exonic
1051130584 9:13855945-13855967 CGACCACAGAGGCAACTGGAAGG + Intergenic
1053168073 9:35858710-35858732 CCAACACAATGGCAACAGGAAGG - Intergenic
1056970431 9:91196461-91196483 CCACCACCCTGGCCACAGGGAGG + Intergenic
1057355881 9:94331063-94331085 CCTCCACAGTGGCCACTGGGAGG + Intergenic
1057651875 9:96926566-96926588 CCTCCACAGTGGCCACTGGGAGG - Intronic
1061025477 9:128046004-128046026 CAACCACATTGGAAACAGTGTGG + Intergenic
1061903472 9:133684755-133684777 CGCCCACAATGGCAGCTGGGAGG + Intronic
1062394155 9:136346003-136346025 TGACCACTGTGGCCACAGGGTGG + Intronic
1185690649 X:2152654-2152676 AGACCACAGTTGCAAGATGGCGG - Intergenic
1192213307 X:69141300-69141322 CAACCTCAGTGGCATCAGAGTGG - Intergenic
1194799333 X:98252142-98252164 GTGCCACAGAGGCAACAGGGTGG + Intergenic