ID: 1004678492

View in Genome Browser
Species Human (GRCh38)
Location 6:17868465-17868487
Sequence CTGCATGTATATATGAAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004678492 Original CRISPR CTGCATGTATATATGAAGTT CGG Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
907878971 1:58525640-58525662 TTGCATTTATACATGAATTTGGG - Intronic
909316050 1:74221016-74221038 CTGGCTGTATATATGAACTAGGG + Intronic
910679494 1:89847890-89847912 CTGCATGTATATATGAGGTAGGG + Intronic
910936596 1:92487816-92487838 CTGCATTTATATATAAAGAAGGG - Intergenic
912145475 1:106788916-106788938 ATGCATGTACATATACAGTTGGG - Intergenic
912325586 1:108757144-108757166 TTGTATGTATATATGAAGATGGG + Intronic
913243177 1:116848227-116848249 ATACATGTATATCTGAACTTTGG + Intergenic
916879863 1:169010085-169010107 CTGCATGGATAGAAGAAGTGTGG + Intergenic
917572088 1:176277936-176277958 CTGTATCTATATATCAAATTAGG + Intergenic
919214924 1:194540947-194540969 CTGCTTTTATAAATGAAGTAAGG - Intergenic
922997008 1:229972139-229972161 ATGCATGTATATATGTAGTGTGG - Intergenic
923429043 1:233903278-233903300 TTGAATCTATAGATGAAGTTGGG + Intergenic
924377106 1:243422627-243422649 TTGCATGTTTAGATGATGTTAGG + Intronic
924485918 1:244484254-244484276 TTGAATGTATAAATCAAGTTGGG - Intronic
924862013 1:247935316-247935338 CTGTATGTATAAATGAAATAAGG - Intergenic
1063061279 10:2556151-2556173 ATGAATCTATATATTAAGTTGGG + Intergenic
1063776389 10:9269953-9269975 ATGTATGTATATATGATGTGTGG - Intergenic
1065345656 10:24745705-24745727 CTCCATGAAAATAAGAAGTTAGG - Intergenic
1065567259 10:27025679-27025701 CTGCATTTAGAAATGAAGTGAGG - Intronic
1065626382 10:27633549-27633571 ATGCATGTATTATTGAAGTTGGG - Intergenic
1066077890 10:31898548-31898570 CTGCATATAAAAATGCAGTTGGG - Intronic
1066391985 10:34984368-34984390 CTGCATCTATACATCAATTTAGG + Intergenic
1067382912 10:45791675-45791697 TAGCATGTATACATAAAGTTAGG - Intronic
1067483369 10:46621702-46621724 CAGCCAGTATATATGATGTTGGG + Intergenic
1067611388 10:47719943-47719965 CAGCCAGTATATATGATGTTGGG - Intergenic
1067941893 10:50663582-50663604 CTGTATGGATATATGAAGTGGGG + Intergenic
1068287134 10:54952562-54952584 TTGCATGAATCTATAAAGTTGGG + Intronic
1068776056 10:60869590-60869612 ATGGATGTATAAATGAACTTGGG - Exonic
1069154287 10:65006192-65006214 CTGAATCTATAGATCAAGTTGGG + Intergenic
1070863136 10:79688533-79688555 CTGTATGGATATATGAAGTGGGG + Intergenic
1072173362 10:92890037-92890059 TTGAATCTATAGATGAAGTTGGG + Intronic
1074540220 10:114358980-114359002 CTGTATGTATATACGAATCTAGG - Intronic
1074617375 10:115082961-115082983 CTGCATGTTTAAAAGAAGATCGG + Intergenic
1075595624 10:123727111-123727133 GTGCATGTAGATGTGAATTTAGG + Intronic
1076089098 10:127664190-127664212 TAGCATGTATTTAGGAAGTTAGG - Intergenic
1080080798 11:28216083-28216105 ATACATGTATATATTAATTTAGG - Intronic
1080292515 11:30687142-30687164 TTATATGTATATATGGAGTTAGG + Intergenic
1080533824 11:33202285-33202307 CTGAATCTATAAATGAGGTTGGG + Intergenic
1080754584 11:35184379-35184401 TTGCAGTTATATTTGAAGTTAGG + Intronic
1080900592 11:36486723-36486745 CTGAATGTTGATTTGAAGTTTGG - Intergenic
1081016230 11:37884845-37884867 TTGCCAGTATATATGAACTTGGG - Intergenic
1081207168 11:40289926-40289948 TTGCATGTATACATTAAGTGTGG + Intronic
1081839761 11:46190584-46190606 CTGAATCTATAAATCAAGTTGGG - Intergenic
1082246878 11:49933888-49933910 ATGAATGTATAGATAAAGTTGGG - Intergenic
1083608761 11:63994960-63994982 CTGAATGTGTATATGCTGTTGGG + Intronic
1084857528 11:71998563-71998585 ATGCATGCATATATTAAGTGTGG - Intronic
1085928222 11:81047993-81048015 GTGTATATATATATGAAGTTTGG - Intergenic
1085928227 11:81048220-81048242 GTGTATATATATATGAAGATTGG - Intergenic
1085928230 11:81048349-81048371 ATTCATATATATATGAAGATTGG - Intergenic
1085928231 11:81048384-81048406 GTGTATATATATATGAAGATTGG - Intergenic
1085928232 11:81048429-81048451 GTGTATATATATATGAAGATTGG - Intergenic
1085928240 11:81048724-81048746 ATTCATATATATATGAAGATTGG - Intergenic
1085928241 11:81048759-81048781 ATTCATATATATATGAAGATTGG - Intergenic
1087595239 11:100245307-100245329 ATGCAAGTTTGTATGAAGTTTGG - Intronic
1088229996 11:107663849-107663871 CTGCATGCATAAATGAAAATGGG - Intronic
1090219660 11:125008092-125008114 GTTAATGTATATATCAAGTTGGG + Intronic
1090841476 11:130492062-130492084 CTGGATCTATAGATCAAGTTAGG + Intergenic
1093162874 12:15769354-15769376 TTGTATGTATATATCAAGTGTGG - Intronic
1095544563 12:43349887-43349909 ATGCATGTATGTATGAATGTAGG + Intergenic
1096810700 12:54167865-54167887 TTGCATGAATAAAAGAAGTTGGG - Intronic
1098862529 12:75726008-75726030 TTACATTTATATTTGAAGTTAGG - Intergenic
1100152817 12:91761502-91761524 ATGTGTGTATATCTGAAGTTCGG - Intergenic
1101279157 12:103233390-103233412 CTGAATCTATAGATCAAGTTGGG + Intergenic
1103653385 12:122451171-122451193 CTGAATGTATATATATGGTTAGG - Intergenic
1106150143 13:27092291-27092313 CTGAACCTATAGATGAAGTTGGG - Intronic
1106837700 13:33653270-33653292 CTGCAAGTTTATAATAAGTTTGG - Intergenic
1107640864 13:42441754-42441776 CTGATTGTATATGTGATGTTGGG - Intergenic
1107704166 13:43082910-43082932 GTGTATATATATATGAAATTTGG + Intronic
1108342170 13:49508030-49508052 TTGCATTTATAGATGAATTTGGG + Intronic
1109111209 13:58320223-58320245 CTGAATGTTTCTATGCAGTTGGG + Intergenic
1109349886 13:61165884-61165906 ATGTATGTATATATAATGTTGGG - Intergenic
1109608862 13:64737207-64737229 TTGCATGTATAGATGCAATTGGG + Intergenic
1109993104 13:70085125-70085147 GTGCATGTATGTATGAATGTGGG + Intronic
1110446463 13:75588228-75588250 CTGAAAGAATATATAAAGTTGGG - Intronic
1110839267 13:80123249-80123271 CTGCATGTGTCTATCATGTTGGG - Intergenic
1114908730 14:27164627-27164649 TTGAATGTATAGATTAAGTTGGG + Intergenic
1117116422 14:52517791-52517813 CTGGAAGAATATATGGAGTTAGG - Intronic
1117196617 14:53345960-53345982 CTGCATGTATTTATCAACTTCGG + Intergenic
1118093600 14:62511014-62511036 CTGCATGTGGATATTCAGTTTGG - Intergenic
1118343846 14:64919387-64919409 CAACTTGAATATATGAAGTTTGG - Intronic
1118578063 14:67264587-67264609 CTGCATGTAGATATCCAGTGTGG + Intronic
1119091022 14:71781456-71781478 CTTCATATGAATATGAAGTTTGG + Intergenic
1119461710 14:74810515-74810537 ATGCATGTGTATATGTAATTTGG + Intronic
1120726974 14:87954769-87954791 CAGCCAGTATATATGATGTTGGG - Intronic
1121087878 14:91160364-91160386 CTGGATGTATTTCTGATGTTTGG - Exonic
1122806877 14:104264293-104264315 TGGCATGAATAAATGAAGTTGGG + Intergenic
1202912449 14_GL000194v1_random:131779-131801 CTACATGTGTATAAAAAGTTGGG - Intergenic
1124599624 15:31122752-31122774 TTGCATCTATAGATCAAGTTGGG - Intronic
1124968044 15:34453922-34453944 CTGAATTTATAAATGAATTTTGG + Intergenic
1126757804 15:51941260-51941282 CTGCATTTATATATGACACTGGG - Intronic
1126984511 15:54288718-54288740 CAGCATGTATATATGACTTTTGG + Intronic
1130581819 15:85144247-85144269 CTGCATGTACATTTGCAATTTGG - Intergenic
1130801285 15:87266211-87266233 CAGGATGTATATATGACATTAGG + Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131661978 15:94526946-94526968 CTGCATATTTACATGATGTTGGG + Intergenic
1131841242 15:96440222-96440244 TTGCATGTATATATGAGCATAGG + Intergenic
1133252969 16:4496481-4496503 CTGCATGCATAAATGCAGTGTGG + Intronic
1140024899 16:71278157-71278179 CCTCATATAGATATGAAGTTGGG - Intergenic
1140558751 16:75952557-75952579 CTGCCTGTATTTATGAAGGAAGG - Intergenic
1142722797 17:1788054-1788076 CTGCTTAAATATATAAAGTTTGG - Intronic
1145914705 17:28565432-28565454 TTACATGTATATATTAATTTGGG - Intronic
1146038671 17:29430924-29430946 CTGCATGATCATCTGAAGTTTGG + Intronic
1147584168 17:41643552-41643574 CTCCATGTCCATATGAATTTGGG - Intergenic
1149254563 17:54810205-54810227 TTGCAAGTATTTTTGAAGTTTGG - Intergenic
1149853613 17:60058180-60058202 CTGAATCTATAGATCAAGTTGGG + Intronic
1151486966 17:74407195-74407217 CAGCATTTATGTATGAACTTTGG + Intergenic
1153504738 18:5785248-5785270 CTGAATGGATATAAAAAGTTGGG - Intergenic
1154282884 18:13022752-13022774 TTGAATGTATAGGTGAAGTTGGG + Intronic
1154421384 18:14231704-14231726 CTGCATTTAGAAATGAAGTGGGG + Intergenic
1155185821 18:23385751-23385773 CTGCATGTTTAGAGGAACTTGGG + Intronic
1156285164 18:35686275-35686297 CTGAATTTATATATGAATTTGGG - Intronic
1157356269 18:46937557-46937579 AAGCATGTATATATGCAGCTTGG - Intronic
1157883427 18:51343696-51343718 ATGCATATATATATAAAATTAGG + Intergenic
1158186023 18:54772557-54772579 CTGGATGTCTATTTGAAATTTGG - Intronic
1158371871 18:56815829-56815851 TTGCATGTATATATGTACATGGG - Intronic
1159742066 18:72184458-72184480 CTGTTTGTAAATATTAAGTTTGG - Intergenic
1159817150 18:73089005-73089027 GTGCATGTATATAAGCATTTGGG + Intergenic
1165554359 19:36617298-36617320 CCTCTTGTTTATATGAAGTTGGG - Intronic
1168538333 19:57190747-57190769 GAGCATGAATATATGAATTTAGG - Intergenic
925565364 2:5247968-5247990 CTGAATCTATAGATCAAGTTGGG - Intergenic
925866002 2:8226458-8226480 CAACATGTATATATGAGGTAAGG - Intergenic
926954951 2:18284222-18284244 ATACATGTATATATGAAGTTGGG - Intronic
928524263 2:32123456-32123478 CTGAATCGATATATGAACTTGGG - Intronic
928729363 2:34212968-34212990 TTAAATGTATATATTAAGTTTGG - Intergenic
929717705 2:44330186-44330208 CTGATTGTATAATTGAAGTTGGG - Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
931188733 2:59979099-59979121 CAGCATGTATAAATGATGCTAGG - Intergenic
931339452 2:61385281-61385303 CTGAATCTATAGATGAATTTCGG - Intronic
932743368 2:74309589-74309611 TTGCATCTATAGATCAAGTTGGG + Intronic
935396256 2:102612394-102612416 CTGAATATATATTTGAAGGTAGG - Intergenic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
935486960 2:103668648-103668670 CTGCATGTATATAGGTAGATAGG + Intergenic
936493828 2:112999847-112999869 CTGCTTTTACATATGAAGATAGG - Intergenic
938198113 2:129350091-129350113 TTGAATGTATAGATCAAGTTGGG + Intergenic
942359507 2:175157325-175157347 CTGCATAGATACATGAAGTGGGG - Intronic
942562259 2:177232940-177232962 CTGCAAGTATCTAAGAGGTTTGG - Intronic
944700753 2:202243881-202243903 CTGAATCTATATATCAAGTTGGG + Intergenic
945341420 2:208660471-208660493 ATGCATGTATAGATCAATTTGGG + Intronic
945674226 2:212835727-212835749 TTGAATCTATAGATGAAGTTAGG + Intergenic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947255531 2:228159686-228159708 CAGGAAGTATATGTGAAGTTTGG + Intronic
947258674 2:228195503-228195525 CTGAATTTATATATTAATTTGGG + Intergenic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
947975353 2:234361247-234361269 CTGCATGTGTACATGAGGTGTGG + Intergenic
948135297 2:235631929-235631951 CTGCATGCATATATGATGGCTGG + Intronic
1170819798 20:19747242-19747264 GTGCATGTATATATGCATGTGGG - Intergenic
1173651602 20:44669560-44669582 CTGAATGGATATAGAAAGTTGGG + Intergenic
1175317203 20:58057031-58057053 CTGGATGTAAATAAGATGTTGGG + Intergenic
1175583487 20:60118758-60118780 CTGCTTGTTTATCTGAAGTCAGG + Intergenic
1176631807 21:9146452-9146474 CTACATGTGTATAAAAAGTTGGG - Intergenic
1177023240 21:15889157-15889179 CTGGATTTATAGATGAATTTGGG - Intergenic
1177733776 21:25062903-25062925 ATCAATGTATAAATGAAGTTTGG - Intergenic
1177760277 21:25395277-25395299 CTGCCTGTTTATTTGAAGTATGG + Intergenic
1177878199 21:26660600-26660622 ATGCACGTAAATATGAAGTAGGG + Intergenic
1178153735 21:29827162-29827184 CTGCATTTCTTTATTAAGTTAGG - Intronic
1178668576 21:34570105-34570127 CTGCATTTATATAGGGATTTAGG - Intronic
1179623794 21:42635956-42635978 ATGAATGTATATATGTAGCTTGG - Intergenic
1181769362 22:25114083-25114105 CTGGTTGAATAAATGAAGTTGGG + Intronic
1184870561 22:47235281-47235303 CTGCATGTATATATGATGGGTGG - Intergenic
949805112 3:7946296-7946318 CTGCATGTTTATATGTACTAAGG - Intergenic
949950495 3:9225083-9225105 CTGAATCTTTTTATGAAGTTTGG - Intronic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
950959115 3:17085986-17086008 TTGAATCTATATATCAAGTTGGG - Intronic
951974078 3:28483551-28483573 TTGAATTTATATATCAAGTTGGG + Intronic
952191951 3:31032722-31032744 CTGAATCTATATATAAAATTGGG + Intergenic
953870543 3:46622851-46622873 CTGCATTTTCATATGAATTTTGG + Intronic
955645736 3:61135267-61135289 CTGCATAAAAATATGAACTTAGG + Intronic
956376494 3:68618828-68618850 GTGCAGGTAAATATGAATTTTGG - Intergenic
956417029 3:69043102-69043124 TTGCTTGTATATCTGAATTTAGG - Intronic
957819564 3:85354216-85354238 CTTGATTTATATATGAATTTTGG + Intronic
958098651 3:88980438-88980460 CTGAATTTATATATGAAGCCAGG - Intergenic
958438748 3:94130202-94130224 CTGTATAGATATATGAAGTGGGG + Intergenic
958581826 3:96035889-96035911 TTGCATCTATAGATCAAGTTGGG + Intergenic
959056183 3:101569770-101569792 AAGCATGTATGTATGATGTTGGG + Intergenic
960464585 3:117981204-117981226 CTGCCACTATATTTGAAGTTTGG - Intergenic
962000680 3:131292480-131292502 TTGCATCTATTGATGAAGTTGGG + Intronic
962858314 3:139370865-139370887 CTGTATGTATATGTGTATTTAGG + Intronic
966269069 3:178083238-178083260 CTTCATGATTATATGAACTTGGG - Intergenic
967353181 3:188537675-188537697 TTGCATCTATATATCAAATTGGG - Intronic
967456861 3:189697619-189697641 TTGAATGTATACATCAAGTTGGG + Intronic
968219964 3:196929762-196929784 CTGTATGTGTATATGATGCTAGG + Intronic
970053437 4:11943250-11943272 TTGCATTTTTATATGAATTTTGG + Intergenic
970622748 4:17841649-17841671 CAATATGAATATATGAAGTTTGG - Intronic
970910880 4:21273836-21273858 GTGCATGCATACATGAAGTGTGG - Intronic
972438544 4:39060134-39060156 TTCCATGTATATATAAAATTAGG + Intronic
972810898 4:42584781-42584803 TTGAATATATATCTGAAGTTTGG - Intronic
973028711 4:45308403-45308425 CTGAATATATAAATCAAGTTGGG + Intergenic
974752196 4:66155540-66155562 CTCCAAATATATATGAAGTATGG + Intergenic
974770811 4:66409888-66409910 TTTCATGAATAAATGAAGTTAGG - Intergenic
975124136 4:70762706-70762728 CTGCATGCATATTTGCATTTTGG - Intronic
975488579 4:74963431-74963453 CTGCATGTATATACCATATTTGG - Intronic
977174435 4:93803067-93803089 CTGCATGTACATAGGATGTGAGG - Intergenic
977232856 4:94472694-94472716 CGGCATTTATAGATAAAGTTGGG + Intronic
978129397 4:105176690-105176712 CTGAATCTATAGATCAAGTTGGG - Intronic
978440017 4:108723852-108723874 CTGAATGAATATAGAAAGTTGGG + Intergenic
980317876 4:131228261-131228283 GTGTATGTATATATCAAGTAAGG + Intergenic
980336643 4:131483171-131483193 CTGAATGTATTTATGATTTTGGG - Intergenic
980476542 4:133324847-133324869 CTCCATGAATATATAAAGGTGGG + Intergenic
980628001 4:135399466-135399488 CGGCATTTATATCTGAAGATTGG - Intergenic
981117742 4:141011862-141011884 GTGCATGTGAATCTGAAGTTTGG - Intronic
981185516 4:141797731-141797753 CTGAATCTATATATCAAGTCGGG + Intergenic
984460701 4:180033091-180033113 CTGTTTATATATATGAAGTATGG - Intergenic
986367627 5:7049292-7049314 CTGCATGAATATGTGTACTTAGG - Intergenic
987559447 5:19500247-19500269 ATGCATGTATGTATACAGTTTGG + Intronic
987937744 5:24489474-24489496 GTGCATAAATATATGAATTTAGG - Intronic
987966371 5:24881538-24881560 GTGTATGTATATATGTATTTTGG + Intergenic
990104470 5:52240195-52240217 CTGAATGTGTATATCAATTTGGG + Intergenic
991168599 5:63593702-63593724 TTTTATATATATATGAAGTTGGG + Intergenic
992316164 5:75557396-75557418 TTGAGTGTATAGATGAAGTTGGG + Intronic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
994582546 5:101663698-101663720 CTGCATGCATTTATGAAGTCAGG + Intergenic
994652361 5:102544791-102544813 CCGCATGCATATATGTAGGTGGG + Intergenic
995262027 5:110115338-110115360 CTGAATGTATATATTAATATAGG - Intergenic
995993819 5:118274838-118274860 CTGCCTATATATATAAAGTGAGG - Intergenic
996826964 5:127694455-127694477 CTTTAATTATATATGAAGTTTGG - Intergenic
1000238745 5:159389015-159389037 CTGAATCTATAGATCAAGTTGGG + Intergenic
1001539210 5:172525443-172525465 CTACATGTAAATATGCAGATTGG - Intergenic
1003375838 6:5576721-5576743 CTGAATGAATACATAAAGTTGGG - Intronic
1004116932 6:12778407-12778429 GTGCCTGTATATTTCAAGTTTGG + Intronic
1004435349 6:15587321-15587343 TTGCATGTATAGATCAATTTGGG - Intronic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1005631402 6:27711588-27711610 CTGAATGAATTTATGAAGTAAGG - Intergenic
1005646351 6:27842456-27842478 CTATATGTCTATATGAAGTTTGG + Intronic
1006851696 6:37103113-37103135 CTGCATGTGTGTGTGAATTTGGG + Intergenic
1009210716 6:60860000-60860022 ATGCATGTATATATGTAGGGGGG + Intergenic
1009772973 6:68167069-68167091 CTGCATTGAAATATGTAGTTTGG + Intergenic
1010047804 6:71467573-71467595 TTGCATGTATTTATGAAGAAGGG - Intergenic
1011067998 6:83349891-83349913 GTGAATGTAGATATCAAGTTCGG - Intronic
1011890536 6:92153808-92153830 CTGGATGTTTCTGTGAAGTTGGG - Intergenic
1012702036 6:102470858-102470880 CTGAATCTATATATCAACTTGGG + Intergenic
1012735630 6:102938009-102938031 CTGAATCTATAGATTAAGTTGGG + Intergenic
1012828450 6:104177268-104177290 GTGCATGTATACATTAAGTTTGG - Intergenic
1012942798 6:105433791-105433813 CTGCCTGTATTTAAGAAGCTGGG + Intergenic
1013392672 6:109702579-109702601 TTGCATGTATATATGCCTTTAGG + Intronic
1014211019 6:118708140-118708162 CTGCAAATATTTATTAAGTTCGG + Intronic
1014600881 6:123410963-123410985 CTGCTTGTAAATATCAAATTTGG - Intronic
1016152058 6:140752996-140753018 CTGCATCTGTATATGAATTTTGG + Intergenic
1017087950 6:150731925-150731947 CAGCATTTAAATATGATGTTGGG - Intronic
1017095479 6:150800914-150800936 TTGTGTGTATATATTAAGTTTGG + Intronic
1017624375 6:156333286-156333308 TTGAATCTATATATCAAGTTGGG + Intergenic
1021063931 7:16148787-16148809 TTGCATATATTTATAAAGTTAGG + Intronic
1021078500 7:16334475-16334497 CTTCAGGTATGTGTGAAGTTTGG - Intronic
1021381646 7:19974656-19974678 TTGTATCTATATATCAAGTTAGG + Intergenic
1022380610 7:29856035-29856057 ATGTATGTATATATGTAGATAGG + Intronic
1022641415 7:32188195-32188217 TTGCTAGTATATATGAAATTGGG + Intronic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1024371032 7:48584009-48584031 TTGCATATTTTTATGAAGTTAGG - Intronic
1026292692 7:69022525-69022547 CTGCGTGTATTCATGAATTTTGG - Intergenic
1027387976 7:77677297-77677319 TTGAATCTATAGATGAAGTTGGG + Intergenic
1027967198 7:85027311-85027333 CTACACGTATATCTCAAGTTTGG + Intronic
1028004314 7:85542877-85542899 TTGAATCTATATATCAAGTTGGG + Intergenic
1028138992 7:87251640-87251662 CTGGATGGATATATGAAGAAAGG - Intergenic
1028263766 7:88697096-88697118 TTGCATGAATAAATAAAGTTTGG + Intergenic
1029035475 7:97515807-97515829 CTGCATTTTTATAGGAAGTGGGG + Intergenic
1030862002 7:114643807-114643829 CTACACTTACATATGAAGTTTGG - Intronic
1030897990 7:115085503-115085525 ATGCCTGTATATATCCAGTTGGG - Intergenic
1031328321 7:120430689-120430711 CTTCATGAAAATATGTAGTTGGG - Intronic
1033876494 7:145825448-145825470 CTTAATGTATATATCAATTTAGG + Intergenic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1035576689 8:712213-712235 TTGAATGTGTATATCAAGTTAGG + Intronic
1036069449 8:5424507-5424529 CTGCAGGAACATATGAAGTATGG + Intergenic
1037555153 8:20014804-20014826 CTATATGTATATATGATGTCAGG - Intergenic
1037712256 8:21364181-21364203 CTTCTTGTATATAGGAAGTCTGG - Intergenic
1037880697 8:22572073-22572095 GTGCATGTATAATTGAAGTGTGG + Intronic
1039624428 8:39032995-39033017 TTGAATGTATAGATCAAGTTGGG + Intronic
1040368839 8:46748000-46748022 CTTCATATATATATAAATTTTGG - Intergenic
1041527305 8:58821865-58821887 CTGCATGAAGATATGCAGTTAGG + Intronic
1042474684 8:69233783-69233805 CTGCATCTTTATATGGAGTAAGG + Intergenic
1048682510 8:136859760-136859782 CTGAATCTATAGATTAAGTTGGG + Intergenic
1050356728 9:4791172-4791194 GTACATGTATATATGAGGTACGG - Intergenic
1051316219 9:15835849-15835871 ATGCATGTATATATGTAAATAGG - Intronic
1051797910 9:20895382-20895404 TTGAATGTATAGATGAAGTTAGG + Intronic
1054361385 9:64123924-64123946 CTGCATTTAGAAATGAAGTAGGG + Intergenic
1054725228 9:68643256-68643278 CAGCAAGTATATTTGAAGATAGG - Intergenic
1055906432 9:81299868-81299890 TTGAATCTATATATCAAGTTTGG - Intergenic
1056166342 9:83944445-83944467 CTACATGGTTATATGAAGGTAGG - Intronic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1058035183 9:100244466-100244488 CTGTATATATATATTAAATTTGG - Intronic
1060754198 9:126199737-126199759 CTAAATGTATATATTAATTTAGG - Intergenic
1062188784 9:135235438-135235460 CTGAATGTATATATCAATTAGGG - Intergenic
1203754634 Un_GL000218v1:114060-114082 CTACATGTGTATAAAAAGTTGGG - Intergenic
1188359412 X:29234059-29234081 CTGCATTTATTTATGGAGCTTGG - Intronic
1188565738 X:31524038-31524060 CTGCATGCATGCATGAAGTCAGG + Intronic
1190551778 X:51589871-51589893 CTGAATCTATAGATCAAGTTGGG - Intergenic
1191969885 X:66801383-66801405 ATGCATGTATATATATATTTAGG - Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1193358819 X:80556112-80556134 CATCATATGTATATGAAGTTTGG - Intergenic
1193918199 X:87393297-87393319 CTTGATGTATATATAATGTTAGG - Intergenic
1194891078 X:99380051-99380073 CTGAATACATAAATGAAGTTGGG - Intergenic
1195856835 X:109340996-109341018 CTCAAAGTATATATGAAGTGGGG + Intergenic
1196523162 X:116697562-116697584 CTGCATGTGTATACCATGTTTGG + Intergenic
1196744627 X:119059166-119059188 ATGCATGTAGATCTTAAGTTTGG - Intergenic
1197014758 X:121609992-121610014 ATGCATGAATAAATGAATTTGGG - Intergenic
1197539440 X:127738579-127738601 TTGAATGTATAGATCAAGTTGGG - Intergenic
1197875475 X:131099816-131099838 CTGCATTTAAATAGGAATTTTGG + Intergenic
1198420667 X:136468458-136468480 CTGCATCAACATATGAATTTCGG - Intergenic
1198494797 X:137181289-137181311 CTACATGAATCTATGAATTTAGG + Intergenic
1198842549 X:140874146-140874168 TTGAATCTATATATCAAGTTAGG - Intergenic
1198842630 X:140875311-140875333 GTGAATGGATAAATGAAGTTTGG + Intergenic
1200853566 Y:7911519-7911541 CTGCCATTATAGATGAAGTTTGG + Intergenic